Bio-nica.info

Genome Transplantation in Bacteria: Changing One
Species to Another
DOI: 10.1126/science.1144622 The following resources related to this article are available online at
www.sciencemag.org (this information is current as of August 3, 2007 ):
including high-resolution figures, can be found in the online Updated information and services,
version of this article at:
can be found at: Supporting Online Material
A list of selected additional articles on the Science Web sites related to this article can be
found at:

, 14 of which can be accessed for free: cites 22 articles
on August 3, 2007 This article appears in the following Information about obtaining of this article or about obtaining permission to reproduce
this article in whole or in part can be found at:
Science (print ISSN 0036-8075; online ISSN 1095-9203) is published weekly, except the last week in December, by theAmerican Association for the Advancement of Science, 1200 New York Avenue NW, Washington, DC 20005. Copyrightc 2007 by the American Association for the Advancement of Science; all rights reserved. The title SCIENCE is a registered trademark of AAAS.

from incompatibility between the two genomes(6). Transplantation of nuclei as intact organelles Genome Transplantation in Bacteria: into enucleated eggs is a well-established proce-dure in vertebrates (7–9). Our choice of the term "genome transplantation" comes from the sim- Changing One Species to Another ilarity to eukaryotic nuclear transplantation inwhich one genome is cleanly replaced byanother.
Carole Lartigue, John I. Glass,* Nina Alperovich, Rembert Pieper, Prashanth P. Parmar, Genome transplantation is a requirement for Clyde A. Hutchison III, Hamilton O. Smith, J. Craig Venter the establishment of the new field of syntheticgenomics. It may facilitate construction of useful As a step toward propagation of synthetic genomes, we completely replaced the genome of a bacterial microorganisms with the potential to solve cell with one from another species by transplanting a whole genome as naked DNA. Intact genomic pressing societal problems in energy production, DNA from Mycoplasma mycoides large colony (LC), virtually free of protein, was transplanted into environmental stewardship, and medicine.
Mycoplasma capricolum cells by polyethylene glycol–mediated transformation. Cells selected for Chemically synthesized chromosomes must tetracycline resistance, carried by the M. mycoides LC chromosome, contain the complete donor eventually be transplanted into a cellular milieu genome and are free of detectable recipient genomic sequences. These cells that result from where the encoded instructions can be expressed.
genome transplantation are phenotypically identical to the M. mycoides LC donor strain as judged We have long been interested in defining a by several criteria.
minimal genome that is just sufficient for cellularlife (10, 11) and have advocated the approach of IthasbeenknowneversinceOswaldAvery's feature of transplantation is that the recipient chemicallysynthesizingagenomeasameansfor pioneering experiments with pneumococcal genome is entirely replaced by the donor ge- testing hypotheses concerning the minimal set of transformation more than six decades ago, nome. There is no recombination between the genes. The societal and ethical implications of that some bacteria can take up naked DNA (1).
incoming and outgoing chromosomes. The result this work have been explored (12, 13).
This DNA is generally degraded or recombined is a clean change of one bacterial species into Fabricating a synthetic cell by this approach on August 3, 2007 into the recipient chromosomes to form genetic requires the introduction of the synthetic genome recombinants. DNA molecules several hundred Work that is related to the process we describe into a receptive cytoplasm. We chose myco- kilobase pairs (kb) in size can sometimes be in this paper has been carried out or proposed for plasmas, members of the class Mollicutes, for taken up. In recent studies with competent various species. Itaya et al. transferred almost an building a synthetic cell. This choice was based Bacillus subtilis cells, Akamatsu and colleagues entire Synechocystis PCC6803 genome into the on a number of characteristics specific to this (2, 3) demonstrated cotransformation of genetic chromosome of a recipient B. subtilis cell using bacterial taxon. The essential features of myco- markers spread over more than 30% of the 4.2- the natural transformation mechanism. The re- plasmas are small genomes, use of UGA to en- megabase pair (Mb) genome using nucleoid sulting chimeric chromosome had the phenotype code tryptophan (rather than a stop codon), and DNA isolated from gently lysed B. subtilis proto- of the B. subtilis recipient cell. Most of the the total lack of a cell wall. A small genome is plasts. Artificial transformation methods that em- Synechocystis genes were silent (5). A schema easier to synthesize and less likely to break ploy electroporation or chemically competent for inserting an entire Haemophilus influenzae during handling. The altered genetic code fa- cells are now widely used to clone recombinant genome as overlapping BACs into an Escherich- cilitates cloning in E. coli because it curtails the plasmids. Generally, the recombinant plasmids ia coli recipient has also been proposed; however, expression of mycoplasma proteins. The absence are only a few kilobase pairs in size, but bacterial those authors have pointed out difficulties arising of a cell wall makes the exterior surfaces of these artificial chromosomes (BACs) greater than 300kb have been reported (4). Recombinant plas- Fig. 1. Demonstration mids coexist with host-cell chromosomes and rep- that the DNA in the licate independently. Two other natural genetic blocks was intact and transfer mechanisms are known in bacteria.
circular, whereas the These are transduction and conjugation. Trans- DNA in the band that duction occurs when viral particles pick up chro- migrated into the gel mosomal DNA from donor bacteria and transfer was linear. (A) A pulsed- it to recipient cells by infection. Conjugation in- field gel loaded with a volves an intricate mechanism in which donor plug containing M.
and recipient cells come in contact and DNA is mycoides LC DNA. The actively passed from the donor into the recipient.
1× TAE buffer gel wasseparated by electropho- Neither of these mechanisms involves a naked resis for 20 hours and DNA intermediate.
then stained with SYBR In this paper, we report a process with a dif- gold. The marker lane ferent outcome, which we call "genome trans- contains Bio-Rad Saccha- plantation." In this process, a whole bacterial romyces cerevisiae ge- genome from one species is transformed into nomic DNA size markers.
another bacterial species, which results in new Note the large amount of cells that have the genotype and phenotype of the DNA remaining in the input genome. The important distinguishing plug. (B) The plugs areshown either before PFGE or after PFGE, and the genome sized band produced after PFGE, and either with The J. Craig Venter Institute, Rockville, MD 20850, USA.
or without treatment with the Plasmid-Safe DNase. The nuclease enzyme digests linear DNA, but has no *To whom correspondence should be addressed. E-mail: effect on circular duplex DNA. These data indicate the band of DNA that migrated into the gel was exonuclease-sensitive and, therefore, linear.
3 AUGUST 2007 VOL 317 SCIENCE www.sciencemag.org bacteria similar to the plasma membranes of tunistic pathogens of goats, but can be grown in At the outset, we explored a number of meth- eukaryotic cells and may simplify our task of the laboratory under Biosafety Level 2 condi- ods for genome transplantation. The process had installing a genome into a recipient cell by allow- tions. In preparation for our experiments, it was three key phases: isolation of intact donor ge- ing us to use established methods for insertion of necessary to sequence both genomes and com- nomes from M. mycoides LC, preparation of large DNA molecules into eukaryotic cells.
pare them to determine the degree of relatedness.
recipient M. capricolum cells, and installation of We elected to develop our genome transplan- We found that 76.4% of the 1,083,241-bp draft the isolated genome into the recipient cells. We tation methods using two fast-growing myco- sequence of the M. mycoides LC genome (14) chose our donor and recipient cells for genome plasma species, Mycoplasma mycoides subspecies could be mapped to the 1,010,023-bp M.
transplantation on the basis of our observation mycoides, Large Colony strain GM12, and capricolum genome (15), and this content that plasmids containing a M. mycoides LC Mycoplasma capricolum subspecies capricolum, matched on average at 91.5% nucleotide identity.
origin of replication complex (ORC) can be strain California kid, as donor and recipient The remaining 24% of the M. mycoides LC established in M. capricolum, whereas plasmids cells, respectively. They divide every 80 and 100 min, genome contains a large number of insertion with an M. capricolum ORC cannot be es- respectively. These organisms are both oppor- sequences not found in M. capricolum.
tablished in M. mycoides LC (16).
Donor Genomic DNA Preparation F i g . 2 . SDS –poly- DNase I after Markers
Manipulation of whole chromosomes in solu- acrylamide gel electropho- tion exposes the DNA to shear forces that can Intact Cells
resis (SDS-PAGE) analysis Before or
Proteinase K
Proteinase K
cause breakage. Thus, it was important to mini- Plug Only
of isolated M. mycoides LC mize genome manipulation during the detergent DNA in agarose blocks and proteolytic enzyme treatments by suspend- shows that there were no ing the cells in agarose blocks. Intact chromo- detectable proteins asso- somes were immobilized in the resulting cavern ciated with the DNA. The in the agarose that originally held the cell. Di- gels were silver-stained.
gested protein components, lipids, RNAs, and (Left) The three lanes sheared genomic DNAs could then be removed labeled "Intact cells" were by dialysis or electrophoresis from the immobi- three dilutions of M. mycoides on August 3, 2007 lized intact genomic DNA.
LC cells that were boiled in Whole, intact genomic DNA isolation was SDS and loaded onto the performed using a CHEF Mammalian Genomic gel. (Middle) Agarose DNA Plug Kit from Bio-Rad. Briefly, we grew blocks with the M. mycoides M. mycoides LC cells containing tetracycline- LC DNA that were boiled inSDS and loaded on the resistance (tetM) and b-galactosidase genes protein gel either before (B) or after (A) PFGE. (Right) To determine whether the material at the top (lacZ) (17) at 37°C to moderate density in SP4 of the gel was protein or DNA, we treated the blocks, before and after PFGE, with DNase I. One of the medium (18), supplemented with 10 mg/ml of markers was DNase I.
tetracycline and, in some experiments, 10 mg/mlof streptomycin. Fifty to 100 ml of cultured cells was reduced to a pellet by centrifugation at Table 1. Results of a series of transplantation experiments.
4575g for 15 min at 10°C. We resuspended cellsin 20 ml of 10 mM Tris (pH 6.5) plus 0.5 M Number of colonies sucrose; spun as before; and resuspended again in Negative controls Total M. capricolum 1 ml ( 1 to 5 × 109 cells/ml). We incubated the cell suspension for 15 min at 50°C, then mixed it with an equal volume of 2% low-melting-point (LMP) agarose in 1× TAE buffer [40 mM Tris- acetate and 1 mM EDTA]. After 5 min at 50°C, the mixture of cells and LMP agarose (2 ml) was distributed in 100-ml aliquots into plug molds.
The 20 plugs solidified at 4°C. Embedded my- coplasma cells were lysed and proteins were digested at 50°C for 24 hours by addition of 6 ml of proteinase K reaction buffer [100 mM EDTA (pH 8.0), 0.2% sodium deoxycholate, and 1% sodium lauryl sarcosine] with 240 ml of protein- ase K (>600 U/ml). The 20 plugs were then washed four times at room temperature for 1 hour in 20 ml of 1× Tris-EDTA buffer [Tris-HCl (20 mM) and EDTA (50 mM), (pH 8.0)] with agitation and stored in 10 ml of Tris-EDTA buffer at 4°C.
We wanted to confirm that our gentle prepa- ration of the genomic DNA yielded intact circular molecules. We subjected some agarose plugs to *We attribute these two colonies to laboratory error, and we never saw any colonies on the no-donor-DNA control plates in any pulsed-field gel electrophoresis (PFGE) in a 1% later experiments.
†After this experiment, we did six experiments not listed here that produced no transplant clones. ‡We LMP gel in TAE, with contour-clamped homo- attribute the higher genome transplantation efficiency in these experiments to the inclusion of streptomycin in the SP4 mediumused to grow the M. mycoides LC donor genomes.
geneous electric field (19) (CHEF DR III, Bio- www.sciencemag.org SCIENCE VOL 317 3 AUGUST 2007 Rad). Pulse times were ramped from 60 to 120 s encasement. Before transplantation experiments, of plug. We calculated each plug contained 10 mg over 24 hours at 3.5 V/cm. After migration, plugs the agarose plugs containing M. mycoides LC of DNA ( 8 × 109 genomes).
were removed from the wells and stored in 10 ml genomic DNA (before or after PFGE) were of Tris-EDTA buffer (as described above) at 4°C washed 2 times 30 min in 1 ml of 0.1× Tris- Recipient Cell Preparation and Genome until used as source of intact genomic DNA for EDTA buffer [Tris-HCl (2 mM) and EDTA (5 Transplantation Reaction Conditions chromosome transplantation experiments. Dur- mM) (pH 8.0)] with gentle agitation. The buffer We prepared the M. capricolum recipient cells ing PFGE, intact circular bacterial chromosomes was completely removed, and the agarose plugs in a 6-ml culture of SOB medium (22) contain- become caught in the agarose and do not migrate, were melted at 65°C with 1/10th volume of 10× ing 17% fetal bovine serum and 0.5% glucose.
whereas full-length linearized DNA, as well as b-agarase buffer [10 mM bis Tris-HCl (pH 6.5) Incubation was at 37°C until the medium pH smaller DNA fragments, RNAs, proteins, and and 1 mM EDTA] for 10 min. The molten agar- was 6.2. Cells (5 to 50 × 107 cells/ml) were then any other charged cellular molecules remaining ose was cooled for 10 min to 42°C and incubated spun in a centrifuge at 4575g for 15 min at 10°C.
after the detergent and enzyme digestion were overnight at the same temperature with 2.5 units As pH decreased from 7.4 to 6.2, regular ovoid removed from the plug by electrophoresis (20).
of b-agarase I (New England Biolabs) per 100 ml M. capricolum cells changed shapes dramatical- A SYBR gold (Molecular Probes)–stainedpulsed-field gel (Fig. 1A) showed a band ofDNA that had the same electrophoretic mobility A Transplants and donor genome profiles
as a 1.125-Mb linear DNA size marker (about thesame size as the M. mycoides LC genome), plusan intense band at the position of the wells, whichsuggested that a large amount of DNA was still inthe plugs. Extensive digestion of the plug and theexcised 1.125-Mb band with Plasmid-Safeadenosine triphosphate (ATP)–dependentdeoxyribonuclease (DNase) (Epicentre Bio-technologies) clearly degraded the excised 1.125-Mb band (Fig. 1B). Plasmid-Safe ATP- on August 3, 2007 dependent DNase digests linear double-strandedDNA to deoxynucleotides and, with lower effi-ciency, closed-circular and linear single-strandedDNA. The enzyme has no activity on nicked orclosed-circular double-stranded DNA or super-coiled DNA. This is compatible with the presenceof a large amount of circular genomic DNA in theplug. As we became more experienced with ge-nome isolation, the amount of apparently linearizedDNA in our preparations diminished.
We analyzed the plugs to confirm that the DNA encased in them was naked. Plugs loadedon SDS polyacrylamide gels after boiling in SDSshowed no detectable protein by silver staining,which indicated that the majority of the DNA wasnaked (Fig. 2). In order to make sure that theDNA was completely deproteinated during the B Untransplanted M. mycoides LC clones and wt M. capricolum
genome transplantation, agarose plugs treatedwith detergent and proteinase K were subjectedto liquid chromatography followed by tandemmass spectrometry (LC-MS/MS) on an ion-trapmass spectrometer (21). Five M. mycoides pep-tides, each for a different protein and from a sep-arate plug, were identified (table S1). BecauseLC-MS/MS analysis is very sensitive and pro-vides excellent sequence coverage, the peptidequantities are extremely small. Only one peptideper protein was detected, which makes it high-ly unlikely that any undigested proteins werepresent in these agarose plug samples. In addi-tion, we detected no M. mycoides LC peptides inplugs not exposed to PFGE. There was also a Fig. 3. Southern blots of (A) 75 transplants and (B) 37 different M. mycoides LC filter clones. The background in the samples run on PFGE of many blots were probed with a PCR amplicon that hybridized to the IS1296 insertion sequences.
peptides not encoded by M. mycoides LC, such Although different samples all had multiple copies of the IS1296, they had slightly different as keratin peptides. All of these peptides, includ- patterns on the blots, which indicated movement of the element. For the transplants (A), the donor ing the five encoded by M. mycoides LC, could cell genomes are shown in the single lanes. As a control (B), Southern blots of recipient cells (wild- be contaminants introduced during the PFGE.
type M. capricolum) are shown in the single lane. The IS196 probe from M. mycoides LC genomic The final step in donor genome preparation DNA was amplified by PCR using primers IS1296P1F (AAGCGTTTAGAATAGAAGGGCTA) and entailed liberation of the DNA from agarose 3 AUGUST 2007 VOL 317 SCIENCE www.sciencemag.org ly. Cells became longer, thinner, and branched. In tion, M. capricolum cells mixed with 10 mg of 10°C, resuspended in 0.7 ml of SP4, and plated poor medium, inhibition of DNA replication due yeast transfer RNA (Invitrogen) were gently on SP4 agar plates containing 3 mg/ml tetracycline to nucleotide starvation is known to induce transferred into the 400 ml of SP4 (–) containing and 150 mg/ml X-gal (5-bromo-4-chloro-3-indolyl branching in M. capricolum cells (23, 24). Cells 20 ml of M. mycoides LC whole-genomic DNA.
were washed once [Tris 10 mM and NaCl 250 mM An equal volume of 2× fusion buffer [Tris 20 mM, The plates were incubated at 37°C until large (pH 6.5)], resuspended with 200 ml of CaCl2 NaCl 500 mM, MgCl2 20 mM, polyethylene blue colonies, putatively M. mycoides LC, formed (0.1 M), and held on ice for 30 min. During that glycol 8000 (PEG; USB Corporation no. 19959) after 3 days. Sometimes, after 10 days smaller period, 20 ml of b-agarase–treated plugs ( 50 ng/ml) 10%] was added, and the contents were mixed by M. capricolum colonies, both blue and white, were delicately transferred into 400 ml of SP4 rocking the tube gently for 1 min. After 50 min at were visible. Thus, all of these colonies were medium without serum [SP4 (–)], with wide-bore 37°C, 10 ml of SP4 was added, and the cells were tetracycline-resistant, as evidenced by their genomic pipette tips, and incubated 30 min at incubated for 3 hours at 37°C to allow recovery.
surviving the antibiotic selection, and only some room temperature. For the genome transplanta- Finally, cells were spun at 4575g for 15 min at expressed b-galactosidase. These colonies mightbe the result of recombination. We observed thatthese colonies appeared after almost twice as M. mycoides LC–specific monoclonal antibody (anti-VchL)
many days as it took for the transplants to become M. capricolum wt M. mycoides LC visible (25). Individual colonies were picked and donor cells 2-6-24 grown in broth medium containing 5 mg/ml oftetracycline. During propagation, the tetracy-cline concentration was progressively increased to10 mg/ml. When we first developed this technique,we subjected all plugs to PFGE. Later, we foundthis step was unnecessary. We observed nosignificant difference in transplantation yield as aresult of PFGE of the plugs.
Every experiment included two negative controls. To ensure that the M. mycoides genomic on August 3, 2007 DNA contained no viable cells, one control was Transplant #10.14-S Transplant #8.2-B processed exactly as described above except noM. capricolum recipient cells were used. Sim-ilarly, in another control, M. capricolum recipientcells were mock-transplanted without any donorDNA. The results of a series of experiments areshown in Table 1. No colonies were ever ob-served in controls lacking recipient cells; thus,the donor DNA was free of any viable contam-inating M. mycoides LC cells. When donor DNA and recipient cells were both present, from 1 to>100 putative transplants were obtained in M. capricolum–specific polyclonal antibodies (anti-VmcE & VmcF)
individual experiments. As we became more ex- M. capricolum wt M. mycoides LC perienced with this technique, the yield of donor cells 2-6-24 transplant colonies increased.
Analysis of Putative Transplants The blue, tetracycline-resistant colonies resultingfrom M. mycoides LC genome transplantationwere to be expected if the genome was success-fully transplanted. However, colonies with thatphenotype could also result from recombinationof a fragment of M. mycoides LC genomic DNAcontaining the tetM and lacZ genes into the Transplant #10.14-S Transplant #8.2-B M. capricolum genome. To rule out recombina-tion, we examined the phenotype and genotypeof the transplanted clones.
Genotype analysis. We analyzed several transplant clones after synthesis with the poly-merase chain reaction (PCR) using primers spe-cific for each species to determine whether theputative transplants had M. mycoides LC se-quences other than the selected tetM and lacZ Note that the dots visible in M. mycoides LC and marker genes. We used PCR primers specific transplant blots are the negative unstained colonies for IS1296 insertion sequences, which are present Fig. 4. Colony hybridization of the M. mycoides LC (genome donor), M. capricolum (recipient cell), in 11 copies in the sequenced M. mycoides LC and transplants from four different experiments that were probed with a polyclonal antibody specific genome, but are absent in the M. capricolum ge- for the M. capricolum VmcE and VmcF surface antigens or with monoclonal antibodies specific for nome. Similarly, we used PCR primers specific the M. mycoides LC VchL surface antigen (29).
for the M. capricolum arginine deiminase gene, www.sciencemag.org SCIENCE VOL 317 3 AUGUST 2007 which is not present in M. mycoides LC. The vincing genotypic analysis that looked at the (59%), respectively, were essentially identical to IS1296 PCR produced an amplicon only when overall genome used Southern blot analysis of the M. mycoides LC donor DNA blot; the rest the template was the M. mycoides wild-type strain the donor and recipient mycoplasmas and a series showed variations in the banding patterns. We or was one of the transplanted clones. Similarly, of putative transplants. Genomic DNA from each assume that variation was the result of IS element the M. capricolum arginine deiminase PCR gen- of those species was digested with the restriction transposition. We hypothesize that mobility of erated an amplicon with the M. capricolum enzyme Hind III and run on a 1% agarose gel.
the IS1296 element may be somewhat sup- template DNA, but not with the M. mycoides LC Southern blots were prepared and probed with pressed in M. mycoides LC cells. However, there wild-type DNA or DNAs from transplant clones.
IS1296 sequences. As expected, no probe hybrid- may be no suppression of transposon mobility The PCR experiments left open the possibility ized to the wild-type M. capricolum lane (Fig. 3A).
immediately following introduction of the donor that fragments of the M. mycoides LC genome We did this analysis on every transplant we ob- genome into the M. capricolum cytoplasm. This containing an IS1296, the tetM gene, and the lacZ tained, as well as a series of M. mycoides LC is evidence of a transitional period when the gene had recombined into the M. capricolum clones (Fig. 3B). Analysis of Southern blots of M. mycoides LC donor genomes reside in a cel- genome in such a way that they destroyed the 37 wild-type M. mycoides LC clones and 75 pu- lular milieu whose M capricolum content is ini- arginine deiminase gene (fig. S1). A more con- tative transplants showed that 34 (92%) and 44 tially high, but diminishes with each cell division.
Next, we did sample sequencing of whole-genome libraries generated from two transplantclones. Our analysis of more than 1300 randomsequence reads from the genome of each clone(totaling 1.09 million bases for each clone)showed that all reads matched M. mycoides LCsequence (26). We cannot rule out the possibilitythat small regions of the donor genomes recom-bined with identical regions of M. capricolumrecipient cell genome; however, those regionswould be very small. There are 20 identicalregions of between 395 and 972 base pairs. The on August 3, 2007 above results were all consistent with thehypothesis that we have successfully introducedM. mycoides LC genomes into M. capricolumfollowed by subsequent loss of the capricolumgenome during antibiotic selection.
Phenotype analysis. We examined the phenotype of the transplanted clones in twoways. In one, we looked at single-gene productscharacteristic of each of these two mycoplasmas.
Using colony-Western blots, we probed donor and recipient cell colonies and colonies from fourdifferent transplants with murine antibodiesspecific for the M. capricolum VmcE and VmcFsurface antigens and with murine antibodiesspecific for the M. mycoides LC VchL surfaceantigen. In both assays, M. mycoides LC VchL–specific antibodies bound the transplant blots with the same intensity as it bound the M.
mycoides LC blots (Fig. 4). Similarly, the anti-bodies specific for the M. capricolum VmcE and Fig. 5. Proteomic analysis. Two-dimensional gels were run using cell lysates from (A) M. mycoides LC,(B) M. capricolum, and (C) a transplant clone (11.1). Standard conditions were used for the separationof protein spots in the first dimension on immobilized pH gradient (IPG) strips (pH range 4 to 7) and inthe second, SDS-PAGE, dimension (molecular mass 8 to 200 kD) (30). The gels were stained withCoomassie brilliant blue G-250, and 96 spots were excised from each of the gels. Spots 71 (A), 23 (B), Fig. 6. Genome transplantation as a function of and 8 (C) were identified as acetate kinase. (B) M. capricolum acetate kinase showed a clear alkaline pH the amount of M. mycoides LC genomic DNA shift. The sequence coverage map for trypsin-digested peptides obtained from MALDI-MS peptide mass transplanted. Transplant colonies were observed fingerprint (PMF) data localizes peptide sequences of acetate kinase [spot 8 (C)] matching mass/charge on two different plates. We observed no colonies ratio (m/z) values in the PMF. Peptide sequences in red were identical to the two Mycoplasma species; on either the no-recipient-cell control or the mock- peptide sequences in blue were unique to M. mycoides LC.
transplanted control plates.
3 AUGUST 2007 VOL 317 SCIENCE www.sciencemag.org VmcF did not bind the to the transplant blots. In genome. We presume that organisms carrying Some bacterial cells have multiple large the second, proteomic analysis, cell lysates of all both donor and recipient cell genomes occurred at chromosomes. This suggests the existence of three strains were examined by using differential least transiently at early times after transplantation.
natural mechanisms for chromosome transfer display in two-dimensional electrophoresis (2-DE) Only 1 recipient cell in 150,000 was transplanted between species. However, we have no evidence gels, followed by identification of proteins spots in our most efficient experiments. This low that genome transplantation as described here with matrix-assisted laser desorption ionization efficiency has so far prevented a demonstration occurs in nature. We observed that in the absence (MALDI) mass spectrometry. The 2-DE spot of transient mosaicism. Although our donor and of treatment with detergent and proteinase K, patterns of the M. mycoides LC and the trans- recipient are distinct species, they are phylogenet- nucleoids from M. mycoides LC cells would not planted clone were identical within the limits of ically close relatives. Genome transplantation produce transplants. Given the improbability of 2-DE; however, the M. capricolum 2-DE spot works for the species we have chosen, but we do the natural occurrence of free-floating bacterial patterns were very different. More than 50% of not know for what other species it will work.
genomes that are both deproteinized and intact, the respective spots could not be matched among Because mycoplasmas are similar to mam- genome transplantation could be a phenomenon the gels (Fig. 5, A to C). More evidence was malian cells with respect to their lack of a cell unique to the laboratory. Still, we have dis- gained from MALDI-MS data that the transplant wall, we experimented with a series of ap- covered a form of bacterial DNA transfer that proteome was identical to the M. mycoides LC proaches that are effective for transferring large permits recipient cells to be platforms for the proteome and did not have any M. capricolum DNA molecules into eukaryotic cells. These production of new species with the use of features. For nearly 90 identified spots of the included cation- and detergent-mediated trans- modified natural genomes or manmade genomes transplant, confidence scores obtained with the fection, electroporation, and compaction of the generated by the methods being developed by Mascot algorithm were invariably equal or higher donor genomes using various cationic agents.
for M. mycoides LC than for M. capricolum None of those approaches proved effective for proteins, despite high sequence homologies; whole-genome transplantation (see SOM). Our References and Notes although there were nine protein spots with con- PEG-based method may be akin to PEG-driven 1. O. T. Avery, C. M. MacLeod, M. McCarty, J. Exp. Med. 79, fidence scores that indicated they were derived cell fusion methods developed for eukaryotic from M. capricolum genes, each case proved to cells. To test this hypothesis, two parental strains 2. T. Akamatsu, H. Taguchi, Biosci. Biotechnol. Biochem.
65, 823 (2001).
be an artifact of either sequencing errors or gene of M. capricolum, one carrying a tetM marker in 3. Y. Saito, H. Taguchi, T. Akamatsu, J. Biosci. Bioeng. 101, boundary annotation errors (table S2). As an ex- the chromosome and the other one with the on August 3, 2007 ample, Fig. 5D visualizes peptides in acetate chloramphenicol-resistance marker (CAT) in a 4. H. Shizuya et al., Proc. Natl. Acad. Sci. U.S.A. 89, 8794 kinase matching only the sequence of the respec- stable ORC plasmid, were both prepared as 5. M. Itaya, K. Tsuge, M. Koizumi, K. Fujita, Proc. Natl.
tive M. mycoides LC protein. Thus, the phenotypic "recipient" cells, mixed, and incubated in the Acad. Sci. U.S.A. 102, 15971 (2005).
assays affirmed that the transplants were likely presence of the fusion buffer as described above 6. R. A. Holt, R. Warren, S. Flibotte, P. I. Missirlis, M. mycoides LC and were not the result of a for transplantation experiments. We plated cells D. E. Smailus, Bioessays 29, 580 (2007).
M. capricolum–M. mycoides LC mosaic produced on SP4 agar containing both tetracycline (3 mg/ml) 7. I. Wilmut, A. E. Schnieke, J. McWhir, A. J. Kind, by recombination between the donor and recipient and chloramphenicol (50 mg/ml). In the presence K. H. Campbell, Nature 385, 810 (1997).
8. J. B. Gurdon, J. A. Byrne, Proc. Natl. Acad. Sci. U.S.A.
cell genomes after the transplantation of the of 5% PEG, we obtained progeny resistant to 100, 8048 (2003).
M. mycoides LC genome and before the two both antibiotics. No colonies grew in the absence 9. R. Briggs, T. J. King, Proc. Natl. Acad. Sci. U.S.A. 38, 455 genomes segregate during cell division.
of 5% PEG. The number of colonies increased 30 times when we pretreated cells with CaCl 10. J. I. Glass et al., Proc. Natl. Acad. Sci. U.S.A. 103, 425 Optimization of Genome Sequencing analysis of 30 clones showed that all 11. C. A. Hutchison III et al., Science 286, 2165 (1999).
had both the tetM and CAT markers in the cells at 12. M. K. Cho, D. Magnus, A. L. Caplan, D. McGee, Science To determine what factors govern genome the expected chromosomal and plasmid loca- 286, 2087 (1999).
transplantation efficiency, we varied the number tions. Thus, we concluded that with our PEG- 13. M. S. Garfinkel, D. Endy, G. E. Epstein, R. M. Friedman, Synthetic Genomics: Options for Governance (report of of M. capricolum recipient cells and the amount based method, M. capricolum cells fuse. Those the project "Synthetic Genomics: Risks and Benefits for of M. mycoides LC genomic DNA used in results agree with membrane studies by Rottem Science and Society," funded by Alfred P. Sloan transplantation experiments. Transplant yield and colleagues demonstrating that fusion of Foundation of New York), in preparation.
was optimal when 107 to 5 × 107 cells were M. capricolum cells is maximal in 5% PEG (27).
14. This whole-genome shotgun project has been deposited at DNA Database of Japan (DDBJ), European Molecular used. At lower donor DNA concentrations, there Gene transfer into Mycoplasma pulmonis was Biology Laboratory (EMBL), and GenBank under the was a linear relation between the amounts of also mediated by PEG at concentrations likely to project accession AAZK00000000. The version described genomic DNA transplanted and transplant yield.
fuse cells, albeit only small DNA segments are in this paper is the first version, AAZK01000000.
Yields began to plateau at higher donor DNA transferred (28). We can imagine that, in some 15. GenBank accession number NC_007633.
concentrations (Fig. 6).
instances, the cells may fuse around the naked 16. C. Lartigue, A. Blanchard, J. Renaudin, F. Thiaucourt, P. Sirand-Pugnet, Nucleic Acids Res. 31, 6610 (2003).
M. mycoides LC genomes. Those genomes, now 17. The donor cells containing the tetM and lacZ genes were Concluding Remarks encapsulated in M. capricolum cytoplasm, ex- made through integration of an M. mycoides LC ORC These data demonstrate the transplantation of press the tetM protein, which allows the large plasmid [see (16)] containing those genes near the whole genomes from one species to another such fused cells to grow and divide once plated on the M. mycoides LC ORC. The location of the plasmidinsertion can be seen in the genome sequence.
that the resulting progeny are the same species as SP4 agar containing tetracycline. Cells lacking 18. J. G. Tully, D. L. Rose, R. F. Whitcomb, R. P. Wenzel, the donor genome. However, they do not explain the M. mycoides genome do not grow. Even- J. Infect. Dis. 139, 478 (1979).
the mechanism of the transplant. This is not tually, now, in the absence of PEG and through 19. G. Chu, D. Vollrath, R. W. Davis, Science 234, 1582 natural DNA transformation, where linear DNA a process of cell division and chromosome seg- 20. S. M. Beverley, Nucleic Acids Res. 16, 925 (1988).
enters the cytoplasm and recombines into the regation, normal, albeit tetracycline-resistant, 21. Materials and methods are available as supporting resident chromosome. Our genome transplanta- b-galactosidase–producing M. mycoides cells material on Science Online.
tion does not entail recombination, and our donor produce large blue colonies on the plate. This basic 22. D. Hanahan, J. Mol. Biol. 166, 557 (1983).
molecule is circular. In addition, our recipient my- approach of PEG-mediated genome transplanta- 23. S. Seto, M. Miyata, J. Bacteriol. 180, 256 (1998).
24. S. Seto, M. Miyata, J. Bacteriol. 181, 6073 (1999).
coplasma cells have not been shown to be com- tion may allow other species to be transplanted 25. To minimize the risk of contaminating our transplant petent for natural transformation, nor are any DNA with naked genomes containing antibiotic-resistance cultures with M. mycoides LC cells from our donor uptake genes identified in the M. capricolum genome preparation process, we used three different www.sciencemag.org SCIENCE VOL 317 3 AUGUST 2007 hoods for our cell culture work: one for M. mycoides LC 30. C. L. Gatlin et al., Proteomics 6, 1530 (2006).
these authors hold Synthetic Genomics, Inc., stock, and donor cell preparation, one for M. capricolum, and one 31. We thank C. Merryman, L. Young, and N. Assad-Garcia the J. Craig Venter Institute owns a significant fraction of for working with transplant clones.
for many discussions about genome transplantation; and Synthetic Genomics, Inc. Following the disclosure policy 26. There was no sequence that was unique to M. capricolum.
D. Rusch, G. Sutton, S. Yooseph, and J. Johnson for of this journal, the authors disclose that the Venter Of the 24 reads that did not match the M. mycoides LC bioinformatics analyses. The bulk of the work was Institute has filed for a patent application on some of the or M. capricolum genome sequences, most were either supported by Synthetic Genomics. The proteome analysis techniques described in this paper.
very short reads (<200 bases) or the result of chimeric was funded in part through the Pathogen Functional clones, which is to be expected owing to the active Genomics Resource Center, managed and funded by the Supporting Online Material transposons in M. mycoides LC and also as part of library Division of Microbiology and Infectious Diseases, National construction. The data for the two transplant clones that Institute of Allergy and Infectious Diseases, NIH, Materials and Methods were sequenced are posted at the National Center for Department of Health and Human Services, and operated Biotechnology Information, NIH, NCBI Trace File by the J. Craig Venter Institute. J.C.V. is Chief Executive Archives (accession numbers 1807995910 through Officer and Co-Chief Scientific Officer of Synthetic Genomics, Inc., a privately held entity that develops 27. M. Tarshis, M. Salman, S. Rottem, Biophys. J. 64, 709 (1993).
genomic-driven strategies to address global energy and 28. A. M. Teachman, C. T. French, H. Yu, W. L. Simmons, environmental challenges. H.O.S. is Co-Chief Scientific 3 May 2007; accepted 21 June 2007 K. Dybvig, J. Bacteriol. 184, 947 (2002).
Officer and on the Board of Directors of Synthetic Published online 28 June 2007; 29. The murine antibodies were gifts from M. Foecking, T. Martin, Genomics, Inc. C.A.H. is Chairman of the Synthetic K. Wise, and M. Calcutt at the University of Missouri.
Genomics, Inc., Scientific Advisory Board. All three of Include this information when citing this paper.
Quantum Hall Effect in a frequency transport properties. We studied theQH signature of the graphene p-n junction and Gate-Controlled p-n Junction found new conductance plateaus at 1 and 3/2 /h,consistent with recent theory addressing equili-bration of edge states at the p-n interface (18).
on August 3, 2007 Graphene sheets were prepared via mechan- ical exfoliation using a method (19) similar tothat used in (10). Graphite flakes were deposited J. R. Williams,1 L. DiCarlo,2 C. M. Marcus2* on 300 nm of SiO2 on a degenerately doped Sisubstrate. Inspection with an optical microscope The unique band structure of graphene allows reconfigurable electric-field control of carrier type allowed potential single-layer regions of graphene and density, making graphene an ideal candidate for bipolar nanoelectronics. We report the to be identified by a characteristic coloration that realization of a single-layer graphene p-n junction in which carrier type and density in two adjacent arises from thin-film interference (Fig. 1A).
regions are locally controlled by electrostatic gating. Transport measurements in the quantum Hall These micrometer-scale regions were contacted regime reveal new plateaus of two-terminal conductance across the junction at 1 and 3/ with thermally evaporated Ti/Au (5/40 nm) that quantum of conductance, e2/h, consistent with recent theory. Beyond enabling investigations in was patterned using electron-beam lithography.
condensed-matter physics, the demonstrated local-gating technique sets the foundation for a Next, a 30-nm layer of oxide was deposited future graphene-based bipolar technology.
atop the entire substrate. As illustrated (Fig. 1B),the oxide consisted of two parts, a nonconvalent of carbon atoms, has recently emerged as sheet. Although global control of carrier type and deposition technique (19) was based on a recipe a fascinating system for fundamental density in graphene using a single back gate has successfully applied to carbon nanotubes (20).
studies in condensed-matter physics (1), as well been investigated by several groups (11–13), The NCFL serves two purposes. One is to create as a candidate for novel sensors (2, 3) and local control (8, 9) of single-layer graphene has a noninteracting layer between the graphene and postsilicon electronics (4–10). The unusual band remained an important technological mile- the Al2O3, and the other is to obtain a layer that is structure of single-layer graphene makes it a stone. In addition, p-n junctions are of great catalytically suitable for the formation of Al2O3 zero-gap semiconductor with a linear (photon- interest for low-dimensional condensed-matter by atomic layer deposition (ALD). The NCFL like) energy-momentum relation near the points physics. For instance, recent theory predicts was synthesized by 50 pulsed cycles of NO2 and where valence and conduction bands meet. Car- that a local step in potential would allow solid- trimethylaluminum (TMA) at room temperature rier type—electron-like or holelike—and density state realizations of relativistic (Klein) tunneling inside an ALD reactor. Next, five cycles of H2O- can be controlled by using the electric-field ef- (14, 15) and a surprising scattering effect known TMA were applied at room temperature to fect (10), obviating conventional semiconductor as Veselago lensing (16), comparable to scatter- prevent desorption of the NCFL. Lastly, Al2O3 doping, for instance via ion implantation. This ing of electromagnetic waves in negative-index was grown at 225°C with 300 H2O-TMA ALD feature, doping via local gates, would allow materials (17).
cycles. To complete the device, a second step of graphene-based bipolar technology devices com- We report the realization of local top gating in electron-beam lithography defined a local top prising junctions between holelike and electron- a single-layer graphene device that, combined gate (5/40 nm Ti/Au) covering a region of the like regions, or p-n junctions, to be reconfigurable with global back gating, allows individual control device that includes one of the metallic contacts.
using only gate voltages to distinguish p (hole- of carrier type and density in adjacent regions of A completed device, similar in design to that a single atomic layer. Transport measurements at shown in the optical image in Fig. 1A, was zero perpendicular magnetic field B and in the cooled in a 3He3 refrigerator and characterized at School of Engineering and Applied Science, Harvard quantum Hall (QH) regime demonstrate that the temperatures T of 250 mK and 4.2 K. Differential University, Cambridge, MA 02138, USA. 2Department ofPhysics, Harvard University, Cambridge, MA 02138, USA.
functionalized aluminum oxide (Al2O3) sepa- resistance, R = dV/dI, where I is the current and V rating the graphene from the top gate does not the source-drain voltage, was measured by *To whom correspondence should be addressed. E-mail:[email protected] significantly dope the layer nor affect its low- standard lock-in techniques with a current bias 3 AUGUST 2007 VOL 317 SCIENCE www.sciencemag.org

Source: http://www.bio-nica.info/biblioteca/Lartigue2007GenomeTransplantation.pdf