Publication.babcock.edu.ng

[Downloaded free from http://www.jcsjournal.org on Tuesday, July 05, 2016, IP: 197.253.33.106]
ORIGINAL RESEARCH REPORT Antibiotic susceptibility/resistant gene profiles of
Group B streptococci isolates from pregnant women in
a tertiary institution in Nigeria
Charles J. Elikwu1,2, Oyinlola O. Oduyebo3, Rose I. Anorlu4, Brigitte König5 1Department of Medical Microbiology and Parasitology, Ben Carson School of Medicine, Babcock University, Ilisan‑Remo, Ogun State, 2Department of Medical Microbiology and Parasitology, Lagos University Teaching Hospital, 3Department of Medical Microbiology and Parasitology, College of Medicine, University of Lagos, 4Department of Obstetrics and Gynecology, College of Medicine, University of Lagos, Idi‑Araba, Lagos, Nigeria, 5Institute of Medical Microbiology and Infection Epidemiology, University of Leipzig, Germany ABSTRACT
Background: Penicillin is recommended as the first‑line agent for intrapartum antibiotic
prophylaxis (IAP). Although Group B Streptococcus (GBS) strains are generally susceptible to penicillin with only occasional resistance, they show varying resistance to erythromycin, clindamycin, and tetracycline. Therefore, knowledge of the resistance profile of GBS in the local environment will be useful for administration of appropriate intrapartum antibiotics prophylaxis. Methodology: Rectovaginal swabs collected from pregnant women were cultured
for GBS using conventional media. Kirby–Bauer disc diffusion method was performed according to the Clinical and Laboratory Standards Institute guidelines on GBS isolates to determine the antibiotic susceptibility patterns of the isolates. Inducible clindamycin resistance was detected by using the D‑zone test. Resistance determinants genes were discerned with conventional polymerase chain reaction. Results: Carriage rates of GBS among pregnant women studied
were 19.7%. GBS colonizing the pregnant mothers were uniformly susceptible (100%) to penicillin, vancomycin, and ceftriaxone. Only three (6.5%) of the isolates showed inducible clindamycin resistance. ermA gene was present in all three GBS isolates with inducible macrolide‑lincosamide‑streptogramin resistance. ermB was absent in all the strains tested. mefA/E gene was carried by two of the macrolide‑clindamycin resistance isolates. tetM gene Address for correspondence:
Dr. Charles J. Elikwu, was carried by all isolates with tetracycline resistance phenotypes. Conclusion: In this study,
Department of Medical all GBS isolates were susceptible to penicillin G, the recommended antibiotic for IAP. The Microbiology and Parasitology, presence of resistance to erythromycin and inducible resistance to clindamycin excludes the Ben Carson School of Medicine, use of these agents as alternatives in cases of penicillin allergy. In this case, vancomycin is Babcock University, Ilisan‑Remo, the drug of choice as recommended in the updated Centers for Disease Control guideline.
Ogun State, Nigeria. Key words: Group B streptococci, inducible clindamycin resistance, pregnant women
To reduce the incidence of neonatal disease caused by beta hemolytic GBS, the Centers for Disease Control (CDC) and Maternal intrapartum beta hemolytic Group B Prevention recommends the use of intrapartum antibiotic Streptococcus (GBS) colonization is the primary risk prophylaxis (IAP) in pregnant women who are vagino‑rectal factor for early‑onset disease in infants.[1] In the absence carriers of GBS.[4,5] Penicillin is recommended as the of any intervention, approximately 2% of infants first‑line agent for IAP, while ampicillin is considered as an born to colonized mothers develop early‑onset GBS This is an open access article distributed under the terms of the Creative Commons Attribution‑NonCommercial‑ShareAlike 3.0 License, which allows Access this article online
others to remix, tweak, and build upon the work non‑commercially, as long as the author is credited and the new creations are licensed under the identical terms.
Quick Response Code:
For reprints contact: [email protected]
How to cite this article: Elikwu CJ, Oduyebo OO, Anorlu RI, Konig B.
Antibiotic susceptibility/resistant gene profiles of Group B streptococci isolates from pregnant women in a tertiary institution in Nigeria. J Clin 2016 JOURNAL OF CLINICAL SCIENCES PUBLISHED BY WOLTERS KLUWER - MEDKNOW [Downloaded free from http://www.jcsjournal.org on Tuesday, July 05, 2016, IP: 197.253.33.106]
Elikwu, et al.: Group B streptococci, inducible clindamycin resistance, pregnant women acceptable alternative.[1,6] In penicillin‑allergic women, who clindamycin (as either of these represents a suitable are not at high risk for anaphylaxis, cefazolin is considered alternative in case of penicillin allergy) and tetracycline the agent of choice for intrapartum chemoprophylaxis for epidemiological reasons.
because of its narrow spectrum of activity and ability to achieve high intra‑amniotic concentrations.[1] In pregnant Pregnant women at gestational age <35 weeks or those women at high risk for penicillin anaphylaxis, clindamycin who had had received antibiotics within 2 weeks before is recommended if the organism is susceptible, and presenting at the antenatal clinic were excluded from vancomycin is recommended if there is clindamycin the study. The Health Research and Ethics Committee resistance or if susceptibility is unknown.[1,2,7] of the LUTH, Lagos, Nigeria, approved this study and every participant gave written informed consent before Although GBS strains are generally susceptible to penicillin with only occasional resistance, they show varying resistance rates to erythromycin, clindamycin, Culture of specimens
and tetracycline.[7,8] The most commonly encountered Vagino‑rectal swabs were collected from 300 pregnant macrolide resistance mechanisms among streptococci women and were inoculated into Todd‑Hewitt broth are ribosomal modification by a methylase encoded by supplemented with 15 μg/ml nalidixic acid and an erm gene[9] and drug efflux by a membrane‑bound 10 μg/ml colistin[12] (Biomerieux, Germany). After protein encoded by a mef gene.[10] The presence of the overnight incubation at 37°C, broths were sub‑cultured erm methylase confers resistance to erythromycin and onto Columbia blood agar plates with 5% sheep blood inducible or constitutive resistance to lincosamides and (Oxoid, United Kingdom) while the solid media were streptogramin B (macrolide‑lincosamide‑streptogramin B incubated at 37°C in ambient air for 24–48 h.
phenotype), whereas the presence of the mef pump confers resistance only to 14‑ and 15‑membered macrolides Identification of isolates
(M phenotype). A second efflux mechanism, encoded by All isolates under investigation were presumptively the mreA gene, has been described for GBS.[11] identified as GBS if they were beta hemolytic, Gram‑positive cocci, catalase negative, and showed positive Christie, In view of the aforementioned, a local knowledge of the Atkins and Munch‑Peterson test (CAMP). PCR targeting resistance profile of GBS will be useful for administration of the GBS species‑specific gene, cfb was done for definitive appropriate antibiotics for prophylaxis. This study aimed to identification. Total DNA extraction from overnight evaluate the antibiotic susceptibility profiles of GBS isolates GBS colonies performed using the DN easy blood from a tertiary healthcare institution in Lagos, Southwest and tissue kits (Qiagen, Germany) according to the Nigeria; and characterize antibiotic resistance genes of manufacturer's instructions. PCR was performed on GBS isolates to advise the local community on GBS empiric GBS DNA extracts using GBS‑specific primers ((Sag59) therapy. This will inform the development of rational 5'‑TTCACCAGCTGTATTAGAAGTA‑3' and reverse (Sag190): interventions and antibiotic guidelines in GBS infections.
5'‑GTTCCCTGAACATTATCTTTGAT‑3') defined as previously described.[13] Amplicons were analyzed by electrophoresis in 1.5% agarose gel (Sigma, USA) stained with ethidium bromide using 1 × TAE buffer (buffer solution Study area and population
containing a mixture of Tris base, acetic acid and EDTA) Participants for this study were recruited from the antenatal (40 mM Tris‑acetate, 1 mM ethylenediaminetetraacetic clinic of the Lagos University Teaching Hospital (LUTH), acid (EDTA); pH 8.0) at 70 V for 60 min. The DNA a tertiary care facility located in South West Nigeria. molecular weight marker (100 bp) (Invitrogen, Germany), Molecular studies were performed at the Institute of was run concurrently to serve as reference for defining Medical Microbiology and Infection Epidemiology, the PCR products. Gels were visualized under UV University of Leipzig, Germany.
trans‑illumination (Biometra, Germany) and the results were transmitted to a computer display system (Biometra, Study design
Germany) and stored.
This was a cross‑sectional study conducted at the LUTH, Lagos from December 2010 to October 2011. A pair of Antibiotic susceptibility testing
vagino‑rectal swab were collected from all consenting All GBS isolates were subjected to antibiotic susceptibility mothers at gestation age 35–37 weeks presenting at using the disk diffusion method as recommended by the the antenatal clinic. GBS was detected in the maternal Clinical and Laboratory Standards Institute (CLSI)[8] using specimens by culture and confirmed by polymerase chain the modified Kirby–Bauer method. The antimicrobial reaction (PCR). GBS isolates were tested for antibiotic agents tested includes penicillin G (10U), clindamycin susceptibility using the disk diffusion method. Phenotypical (2 μg), erythromycin (15 μg), vancomycin (30 μg), and molecular antibiotic resistance testing were conducted ciprofloxacin (5 μg), ceftriaxone (30 μg), tetracycline (30 μg) for isolates that showed resistance for erythromycin and and co‑trimoxazole (25 μg) (Oxoid, UK). The diameter of JOURNAL OF CLINICAL SCIENCES, VOLUME 13, NUMBER 3, JULY-SEPTEMBER 2016

[Downloaded free from http://www.jcsjournal.org on Tuesday, July 05, 2016, IP: 197.253.33.106]
Elikwu, et al.: Group B streptococci, inducible clindamycin resistance, pregnant women the zone of inhibition was measured in millimeters using resistant to erythromycin were positive for inducible a meter rule and interpreted according to CLSI guidelines clindamycin resistance. Erythromycin resistance gene with reference to tables of interpretative criteria. ermA was found in the three erythromycin‑clindamycin Streptococcus agalactiae control strains Ia (2008232728), inducible resistance and absent in the only one strain Ib (2008232729), III (2008232582) and V (2008232731) with intermediate susceptibility [Figure 1]. However, from CDC were used as control strains. The results were erythromycin resistance gene ermB was absent in all the described by frequency number and percentage.
four strains tested. The mefA/E gene was carried by two of the macrolide‑clindamycin resistance isolates [Figure 2]. Phenotypic and molecular antibiotic resistance testing The tetM gene was carried by all isolates that showed were conducted for isolates that showed resistance to tetracycline resistance phenotypes [Figure 3] while tetO erythromycin, clindamycin, and tetracycline.
gene was completely absent.
Phenotypic antibiotic resistance testing
Inducible clindamycin resistance phenotype was performed on all GBS isolates with erythromycin resistance using GBS is the leading cause of early‑onset neonatal sepsis the D‑zone disk diffusion method on Mueller‑Hinton in most countries of the world. Universal screening is agar supplemented with 5% defibrinated sheep blood recommended for pregnant women at 35–37 weeks' (Oxoid, UK) using erythromycin and clindamycin disks as gestation.[2] Therefore, we conducted antibiotic recommended by the CLSI.[8] Isolates with blunting of the susceptibility profiles of GBS isolates with the primary inhibition zone around the clindamycin disk adjacent to objective of evaluating the antibiogram among GBS isolates the erythromycin disk (D‑zone positive) were considered from Nigerian pregnant women. In this study, we found to have inducible clindamycin resistance[14,15] and were presumed to be resistant. Susceptibility to clindamycin with no blunting defined the M phenotype (efflux mechanism).
Table 1: Antibiotic susceptibility profile of
maternal GBS strains
The CDC S. agalactiae serotype III (2008232582) was used as a control strain.
Resistance
susceptibility n (%)
Genotypic antibiotic resistance testing
Penicillin G (10U) Erythromycin (15ug) Antibiotic resistance genes of isolates resistant to Clindamycin (2ug) erythromycin, clindamycin, and tetracycline, was Vancomycin (30ug) determined. PCR was performed on GBS resistant isolates Tetracycline (30ug) using primers erm A 1/2, erm B 1/2, and mef AE ½ Ceftraixone (30ug) (BioteZ, Berlin, Germany) for the erm (A), erm (B) and mef (A) genes respectively. The sequences of the primer SXT (1.25/23.75ug) sets and PCR conditions[14,17] were as previously described. All isolates that expressed phenotypic resistance to tetracycline were also tested for the presence of the tet (M) and tet (O) tetracycline resistance determinants[18] using tet M 1/2 and tet O 1/2 primers respectively (BioteZ, Berlin, Germany). Amplicons were analyzed by electrophoresis in 1.5% agarose gel (Sigma, USA) stained with ethidium bromide using 1 × TAE (40 mM Tris‑acetate, 1 mM EDTA; pH 8.0) as stated previously.
Fifty‑nine (19.7%) out of 300 pregnant women were enrolled for the study showed GBS‑vaginal colonization. All 46 available GBS isolates colonizing the pregnant mothers were uniformly susceptible (100%) to penicillin, vancomycin, and ceftriaxone while 44 (95.7%) and 41 (89.1%) were resistant to tetracycline and Lanes 1, 3-4: GBS ermA positive isolates Lane 2: GBS ermA negative isolate trimethoprim‑sulfamethoxazole, respectively [Table 1]. Lane 5: Positive control Only three (6.5%) of the isolates showed erythromycin Lane 6: Negative control ML: DNA molecular ladder resistance while another three were resistant to clindamycin with a lone intermediate susceptibility. All the three isolates Figure 1: Gel electrophoresis identification of GBS erm (A) resistant gene
JOURNAL OF CLINICAL SCIENCES, VOLUME 13, NUMBER 3, JULY-SEPTEMBER 2016

[Downloaded free from http://www.jcsjournal.org on Tuesday, July 05, 2016, IP: 197.253.33.106]
Elikwu, et al.: Group B streptococci, inducible clindamycin resistance, pregnant women Lanes 1, 3, 4, 6, 8-12: GBS tetM positive isolates Lanes 2, 5, 7: GBS tetM negative isolates Lanes 3-4: GBS mef(A/E) positive isolates Lane 13: Positive control Lanes 1-2, 5: GBS mef(A/E) negative isolates Lane 14: Negative control Lane 6: Positive control ML: DNA molecular ladder Lane 7: Negative control ML: DNA molecular ladder Figure 3: Gel electrophoresis identification of GBS tetM resistant gene
Figure 2: Gel electrophoresis identification of GBS mef (A/E) resistant gene
Our study provides valuable information about current that all GBS isolates remain susceptible to penicillin G, knowledge of antibiogram of GBS isolates among pregnant the recommended antibiotic for IAP.[2] However, a study women in Nigeria. It is however limited by the small sample from Obafemi Awolowo University Teaching Hospital, size or rather a small size of GBS isolates and the conduct of Ile‑Ife Nigeria in the same geopolitical zone of our country the study in a lone institution. Nevertheless, the antibiotics reported uniform resistance of all GBS isolates to penicillin, situation is similar across the country as Nigeria currently ampicillin and clindamycin.[19] has no policy and guidelines regulating antibiotics in place; we believe that the results of our study were a true Though this study recorded a low rate of resistance (6.5%) reflection of the situation GBS antibiogram among pregnant to erythromycin and another 6.5% to clindamycin, a women in Nigeria.
number of literature has showed that the proportions of GBS isolates with in vitro resistance to clindamycin Financial support and sponsorship
or erythromycin, have increased over the past two A short‑term research grant from DAAD (German Academic decades.[12,20‑22] At this juncture, a limitation of this study Exchange Program).
is highlighted: A total of 46 GBS isolates analyzed was low compared to 801 isolates by Milledge et al.[22] whose Conflicts of interest
study stretched over a 5 years period. Even at that, an There are no conflicts of interest.
upward antibiotic resistance trend is predicted given the high rates of antibiotic misuse and abuse in Nigeria.[23] Resistance to erythromycin is associated frequently but 1. Verani JR, McGee L, Schrag SJ; Division of Bacterial Diseases, not always with resistance to clindamycin.[15] The National Center for Immunization and Respiratory Diseases, CDC guideline on prevention of perinatal GBS disease Centers for Disease Control and Prevention (CDC). Prevention recommends that erythromycin is no longer acceptable of perinatal group B streptococcal disease – Revised guidelines for empiric prophylaxis because of increasing rates from CDC, 2010. MMWR Recomm Rep 2010;59:1‑36.
2. Cagno CK, Pettit JM, Weiss BD. Prevention of perinatal of resistance.[2,20] In such a case clindamycin (900 mg group B streptococcal disease: Updated CDC guideline. Am intravenously every 8 h until delivery) is the drug of Fam Physician 2012;86:59‑65.
choice if the GBS isolate is susceptible to clindamycin and 3. Adair CE, Kowalsky L, Quon H, Ma D, Stoffman J, McGeer A, erythromycin, and if there is no inducible clindamycin et al. Risk factors for early‑onset group B streptococcal disease in neonates: A population‑based case‑control study. CMAJ resistance. Vancomycin (1 g intravenously every 12 h until delivery) is recommended if testing shows resistance or 4. Koenig JM, Keenan WJ. Group B Streptococcus and inducible resistance to clindamycin. If erythromycin and early‑onset sepsis in the era of maternal prophylaxis. Pediatr clindamycin susceptibility tests were not performed, or if Clin North Am 2009;56:689‑708.
5. Jauréguy F, Carton M, Panel P, Foucaud P, Butel MJ, results are not available at the time of labor, vancomycin Doucet‑Populaire F. Effects of intrapartum penicillin should be used in women at high risk of anaphylaxis.[2] The prophylaxis on intestinal bacterial colonization in infants. resistance mechanisms of GBS isolates to erythromycin in J Clin Microbiol 2004;42:5184‑8.
this study was accounted for by the presence of the genes 6. Berner R. Significance, management and prevention of Streptococcus agalactiae infection during the perinatal that expresses erythromycin methylases and macrolide period. Expert Rev Anti Infect Ther 2004;2:427‑37.
efflux in the resistant isolates.
7. Chaudhuri K, Gonzales J, Jesurun CA, Ambat MT, JOURNAL OF CLINICAL SCIENCES, VOLUME 13, NUMBER 3, JULY-SEPTEMBER 2016

[Downloaded free from http://www.jcsjournal.org on Tuesday, July 05, 2016, IP: 197.253.33.106]
Elikwu, et al.: Group B streptococci, inducible clindamycin resistance, pregnant women Mandal‑Chaudhuri S. Anaphylactic shock in pregnancy: A macrolide‑lincosamide‑streptogramin B resistance determinants. case study and review of the literature. Int J Obstet Anesth Antimicrob Agents Chemother 1999;43:2823‑30.
16. Clancy J, Petitpas J, Dib‑Hajj F, Yuan W, Cronan M, 8. Clinical and Laboratory Standards Institute. Performance Kamath AV, et al. Molecular cloning and functional analysis Standards for Antimicrobial Susceptibility Testing; of a novel macrolide‑resistance determinant, mefA, from Twenty‑Second Informational Supplement. Wayne, PA, USA: Streptococcus pyogenes. Mol Microbiol 1996;22:867‑79.
Clinical and Laboratory Standards Institute; 2013. p. 1‑184.
17. Sutcliffe J, Grebe T, Tait‑Kamradt A, Wondrack L. Detection 9. Weisblum B. Inducible resistance to macrolides, lincosamides of erythromycin‑resistant determinants by PCR. Antimicrob and streptogramin type B antibiotics: The resistance Agents Chemother 1996;40:2562‑6.
phenotype, its biological diversity, and structural elements 18. Trzcinski K, Cooper BS, Hryniewicz W, Dowson CG. that regulate expression – A review. J Antimicrob Chemother Expression of resistance to tetracyclines in strains of 1985;16 Suppl A: 63‑90.
methicillin‑resistant Staphylococcus aureus. J Antimicrob 10. Luna VA, Coates P, Eady EA, Cove JH, Nguyen TT, Roberts MC. A variety of gram‑positive bacteria carry mobile 19. Onipede A, Adefusi O, Adeyemi A, Adejuyigbe E, mef genes. J Antimicrob Chemother 1999;44:19‑25.
Oyelese A, Ogunniyi T. Group B Streptococcus carriage 11. Clancy J, Dib‑Hajj F, Petitpas JW, Yuan W. Cloning and during late pregnancy in Ile‑Ife, Nigeria. Afr J Clin Exp characterization of a novel macrolide efflux gene, mreA, from Microbiol 2012;13:135‑43. Available from: http://www.ajol.
Streptococcus agalactiae. Antimicrob Agents Chemother info/index.php/ajcem/article/view/81774. [Last accessed on 2016 Jan 25].
12. Joachim A, Matee MI, Massawe FA, Lyamuya EF. Maternal 20. Lin FY, Whiting A, Adderson E, Takahashi S, Dunn DM, and neonatal colonisation of group B Streptococcus at Weiss R, et al. Phylogenetic lineages of invasive and Muhimbili National Hospital in Dar es Salaam, Tanzania: colonizing strains of serotype III group B Streptococci from Prevalence, risk factors and antimicrobial resistance. BMC neonates: A multicenter prospective study. J Clin Microbiol Public Health 2009;9:437.
13. Ke D, Ménard C, Picard FJ, Boissinot M, Ouellette M, Roy PH, 21. Edwards MS, Baker CJ. Streptococcus agalactiae. In: et al. Development of conventional and real‑time PCR assays Mandell GL, Bennett JE, Dolin R. editors. Principles and for the rapid detection of group B streptococci. Clin Chem Practice of Infectious Diseases. 6th ed. Philadelphia: Churchill Livingstone; 2005. p. 2423‑34.
14. Kataja J, Seppälä H, Skurnik M, Sarkkinen H, Huovinen P. 22. Milledge J, Calis JC, Graham SM, Phiri A, Wilson LK, Different erythromycin resistance mechanisms in group C Soko D, et al. Aetiology of neonatal sepsis in Blantyre, and group G streptococci. Antimicrob Agents Chemother Malawi: 1996‑2001. Ann Trop Paediatr 2005;25:101‑10.
23. Ekwochi U, Chinawa JM, Obi I, Obu HA, Agwu S. Use and/or 15. Roberts MC, Sutcliffe J, Courvalin P, Jensen LB, misuse of antibiotics in management of diarrhea among children Rood J, Seppala H. Nomenclature for macrolide and in Enugu, Southeast Nigeria. J Trop Pediatr 2013;59:314‑6.
New features on the journal's website
Optimized content for mobile and hand-held devices
HTML pages have been optimized of mobile and other hand-held devices (such as iPad, Kindle, iPod) for faster browsing speed.
Click on [Mobile Full text] from Table of Contents page.
This is simple HTML version for faster download on mobiles (if viewed on desktop, it will be automatically redirected to full HTML version)
E-Pub for hand-held devices
EPUB is an open e-book standard recommended by The International Digital Publishing Forum which is designed for reflowable content i.e. the
text display can be optimized for a particular display device.
Click on [EPub] from Table of Contents page.
There are various e-Pub readers such as for Windows: Digital Editions, OS X: Calibre/Bookworm, iPhone/iPod Touch/iPad: Stanza, and Linux:
Calibre/Bookworm.
E-Book for desktop
One can also see the entire issue as printed here in a ‘flip book' version on desktops.
Links are available from Current Issue as well as Archives pages.
Click on
JOURNAL OF CLINICAL SCIENCES, VOLUME 13, NUMBER 3, JULY-SEPTEMBER 2016

Source: http://publication.babcock.edu.ng/docs/MBBS/elikwuc/1467722257.pdf