Erbeofficinali.org

Terpinen-4-ol, The Main Component of Melaleuca Alternifolia (TeaTree) Oil Inhibits the In Vitro Growth of Human Melanoma Cells Annarica Calcabrini, Annarita Stringaro, Laura Toccacieli, Stefania Meschini, Manuela Marra, Marisa Colone,Giuseppe Salvatore, Francesca Mondellow, Giuseppe Arancia, and Agnese MolinariLaboratorio di Ultrastrutture, Laboratorio di Tossicologia Comparata ed Ecotossicologia and wLaboratorio di Batteriologia e Micologia Medica, Istituto Superioredi Sanita , Rome, Italy The search for innovative therapeutic approaches based on the use of new substances is gaining more interest inclinical oncology. In this in vitro study the potential anti-tumoral activity of tea tree oil, distilled from Melaleucaalternifolia, was analyzed against human melanoma M14 WT cells and their drug-resistant counterparts, M14adriamicin-resistant cells. Both sensitive and resistant cells were grown in the presence of tea tree oil atconcentrations ranging from 0.005 to 0.03%. Both the complex oil (tea tree oil) and its main active componentterpinen-4-ol were able to induce caspase-dependent apoptosis of melanoma cells and this effect was more evidentin the resistant variant cell population. Freeze-fracturing and scanning electron microscopy analyses suggestedthat the effect of the crude oil and of the terpinen-4-ol was mediated by their interaction with plasma membrane andsubsequent reorganization of membrane lipids. In conclusion, tea tree oil and terpinen-4-ol are able to impair thegrowth of human M14 melanoma cells and appear to be more effective on their resistant variants, which expresshigh levels of P-glycoprotein in the plasma membrane, overcoming resistance to caspase-dependent apoptosisexerted by P-glycoprotein-positive tumor cells.
Key words: tea tree oil/melanoma cells/multidrug resistance.
J Invest Dermatol 122:349 – 360, 2004 Cutaneous melanoma is a highly invasive and metastatic modulating compounds are bound to certain macromole- tumor, highly refractory to chemotherapy. Melanoma cells cules such as serum proteins; (3) hematologic malignancies are known to exhibit both in vitro and in vivo a high level of appear to be more sensitive to MDR modulators than solid intrinsic resistance to various cytostatic agents (Schaden- tumors, where different mechanisms are responsible for the dorf et al, 1994). Moreover, following drug treatment, MDR phenotype. Therefore, the search for innovative melanoma cells can acquire the classical multidrug resis- therapeutic approaches, based on the use of new sub- tance (MDR) phenotype, characterized by reduced intracel- stances effective against resistant tumors, is gaining more lular drug accumulation and high resistance index. Several and more interest in clinical oncology.
studies suggest that a class of specific drug-transporter Tea tree oil (TTO) is an aboriginal Australian traditional proteins, including P-glycoprotein (P-gp) (Berger et al, 1994; medicine for bruises, insect bites, and skin infections. It was Alvarez et al, 1995; Molinari et al, 1998, 2000) and MDR- rediscovered in the 1920s as a topical antiseptic with more related protein (MRP1) (Cole et al, 1992), might play a effective activity than phenol. TTO is the essential oil steam central part in the establishment of the MDR phenotype in distilled from Melaleuca alternifolia, a species of northern melanoma cells. Several in vitro and in vivo studies have New South Wales, Australia. The oil is considered non- been performed as an attempt to reverse the drug poisonous, it possesses a pleasant odor and it is included in resistance phenotype and to develop innovative chemother- a large range of products for skin and wound care. In fact, apeutic strategies effective against MDR tumors. Most of the lipophilic nature of the oil that enables it to penetrate the the MDR modulators, such as calcium channel blockers skin, suggests it may be suitable for topical therapeutic use (e.g., verapamil), calmodulin inhibitors (e.g., trifluoperazine), in the treatment of fungal mucosal and cutaneous infec- and immunosuppressive agents (e.g., cyclosporine A, CsA) tions. The chemical composition of TTO has been well (Sikic, 1993) induce a competitive inhibition of the P-gp defined and consists of a complex mixture of monoterpe- molecule activity. Unfortunately, the use of these sub- noids of which about 50% are oxygenated and about 50% stances in vivo presents plenty of obstacles due to a are hydrocarbons (Brophy et al, 1989). The active compo- number of factors: (1) inhibitory concentrations of modula- nent of the oil is thought to be terpinen-4-ol, although tors are very toxic to patients (hypotension, heart block, synergistic effects from other terpenes cannot be excluded myelosuppression); (2) bioavailability decreases as these (Altman, 1988). TTO exhibits broad-spectrum anti-microbialactivity (Markham, 1999), which can be principally attributedto terpinen-4-ol (Southwell et al, 1993; Carson and Riley,1995) and there are susceptibility data on a wide range of Abbreviations: ADR, adriamicin resistent; DOX, doxorubicin; MDR,multi-drug resistance; TTO, tea tree oil.
gram-positive and negative bacteria (Altman, 1988; Carson Copyright r 2004 by The Society for Investigative Dermatology, Inc.
THE JOURNAL OF INVESTIGATIVE DERMATOLOGY et al, 1998; Anderson and Fennessy, 2000; Caelli et al, 2000; Quantitative data were based on peak area normalization May et al, 2000; Zhang and Robertson, 2000). Moreover, the without using a correction factor.
anti-fungal activity of TTO against yeasts and dermato- phytes is reported in several papers (Nenoff et al, 1996; g-terpinene, 9.76% a-terpinene, 3.71% terpinolene, 3.57% Syed et al, 1999; Ernst and Huntley, 2000; D'Auria et al, 1,8 cineole, 3.09% a-terpineol, 2.82% p-cimene, 2.42% 2001). TTO has been used in the treatment of acne (Bassetet al, 1990) and Tinea pedis (Tong et al, 1992). Finally,several studies investigated the potential anti-inflammatoryproperties of TTO and recent data demonstrated thatterpinen-4-ol suppresses inflammatory mediator productionby activated human monocytes (Hart et al, 2000).
In this in vitro study the potential anti-tumoral activity of TTO was analyzed against human melanoma M14 wild type(WT) cells and their drug-resistant counterparts, M14adriamicin-resistant (ADR) cells, selected by prolongedexposure to doxorubicin (DOX). Results herein reporteddemonstrate that both TTO and its main componentterpinen-4-ol are able to impair the growth of human M14melanoma cells and appear to be more effective on thedrug-selected resistant cell line M14 ADR, which expresshigh levels of P-gp in the plasma membrane.
Selection and characterization of resistant melanomacells Human melanoma M14 WT cells were cultured in thepresence of the anti-tumoral drug DOX, an anthracyclinicantibiotic largely employed in anti-neoplastic regimens. Adrug-resistant cell line (M14 ADR) was selected afternumerous passages (
100) in the presence of 40 mM DOX.
In order to evaluate the drug sensitivity of M14 ADR cells, a cloning efficiency assay was carried out. Resistant cellsshowed a remarkable decrease of sensitivity to DOX with aresistance index of 48. The acquired resistance to the anti-tumoral drug matched the appearance of P-gp on theplasma membrane (Fig 1a,b), as revealed by flow cyto-metric analysis. The expression of P-gp was confirmed bywestern blotting (Fig 1c) and reverse transcription–PCRexperiments (Fig 1d). The low expression of P-gp in drug-sensitive M14 cells was not detected by western blottechnique. On the contrary, in agreement with previousstudies performed by our group (Molinari et al, 1998),reverse transcription–PCR of M14 WT cells demonstratedthe presence of the mRNA of MDR1 gene.
Chemical identification and quantitative estimation ofTTO Chemical components were identified by comparingtheir GC retention times, the Kovat's Indices (Adams, 1995)and GC/MS spectra with those of the reference substances.
Figure 1Expression of P-gp on human melanoma M14 sensitive and drug-selected cells. (a,b) Flow cytometric determination of surface P-gp inhuman melanoma M14 WT (a) and M14 ADR (b) cells labeled withMoAb MM4.17 (black histograms) or mouse isotypic globulins (negativecontrol, dotted histograms). (c) Western blot of cell lysates from M14WT (1) and M14 ADR (2) cells. The membrane was probed with theprimary MoAb to P-gp (MoAb C219) and to actin (MoAb 1501). (d)Detection of MDR1 mRNA. PCR amplification products (40 cycles)fractioned by 2% agarose gel and visualized by ethidium bromide forhuman breast carcinoma MCF7-DX (positive control) (2), humanmelanoma M14 WT (3), and M14 ADR (4) cells. (1) DNA marker.
122 : 2 FEBRUARY 2004 EFFECTS OF TEA TREE OIL ON MELANOMA CELLS decrease of the cell pool size in the resistant variant. Thetwo higher concentrations (0.02, 0.03%) were strongly inhi-bitory for the growth of both parental M14 WT and resistantM14 ADR cells. The effect proved to be more pronounced inthe M14 ADR cell line than in M14 WT one, however.
Induction of cell apoptosis Apoptosis as revealed by theannexin V binding method (Vermes et al, 1995) was seenunder treatment with TTO ranging from 0.005 to 0.02% for48, 72, and 96 h. After 72 and 96 h of treatment with 0.02%TTO, an increased number of necrotic cells (positive forboth annexin V and PI) was revealed, which impaired acorrect AI determination. As shown in Fig 3 the maximum AIwas reached under the treatment with 0.02% TTO for 48 hboth for M14 WT and M14 ADR cells. After 72 and 96 h oftreatment with 0.02% TTO, an increased number of necroticcells (positive for both annexin V and PI) was revealed,which impaired a correct AI determination. It is interesting tonote that the AI values detected in treated samples weregenerally greater in the resistant variant cell population thanin the parental one.
Noteworthy, M14-resistant cells appeared to be less sensitive to caspase-dependent apoptotic stimuli, such asserum starvation (Fig 4) or anti-Fas MoAb-induced apoptosis(Fig 5), even if they expressed equivalent levels of surfaceFas as determined by flow cytometry (data not shown).
There was a negative correlation between the AI and the cell pool size. In Table I the negative exponential correla-tions between cell pool size and AI of M14 WT and M14ADR melanoma cells after 48, 72, and 96 h of treatment arereported.
The active component of the oil is thought to be terpinen- 4-ol (Altman, 1988); thus, to analyze its contribution to theinduction of apoptosis, experiments performed with 0.01%pure terpinen-4-ol for 48 h were carried out. The choice ofterpinen-4-ol concentration was determined by the resultsof the chemical identification and quantitative estimation ofTTO used in this work (42.35% terpinen-4-ol). Interestingly,as evaluated by measuring DNA fragmentation with TUNEL assay, also terpinen-4-ol alone induced a higher percentage (a) Growth curves of human melanoma M14 WT cells grown in the of apoptotic cells in the resistant M14 ADR cell population, absence (ctr) and in the presence of different concentrations of when compared with the sensitive one (Fig 6). Moreover, in TTO. (b) Growth curves of human melanoma M14 ADR cells grown inthe absence (ctr) and in the presence of different concentrations of order to gain insight into the involvement of P-gp in the TTO. Mean values and SD from three different experiments.
response of M14 cells to the induction of apoptosis byterpinen-4-ol, the treatment was performed in the absence or in the presence of CsA, at the concentration (5 mM) that a-thujene, 0.94% aromadendrene, 0.87% myrcene, 0.73% proved to be able to inhibit the transport function of P-gp b-pinene, 0.40% sabinene, and 0.34% a-phellandrene. The (Molinari et al, 2000). The inhibition of the MDR transporter oil was observed to be of terpinen-4-ol type according to did increase noticeably the percentage of apoptotic cells in International Standard ISO 4730: 1996.
the M14 WT cell line and to a lesser extent in M14 ADR cells.
Furthermore, both M14 WT and M14 ADR cells were Effects of TTO on cell growth In this study human treated with 0.02% TTO or 0.01% terpinen-4-ol for 48 h, melanoma M14 WT and M14 ADR cells were grown in the in the absence or in the presence of caspase inhibitors presence of TTO at concentrations ranging from 0.005 to (Fig 7a,c). To inhibit the activation of caspases, cells were 0.03%. Changes in the cell pool size during the exposure pretreated for 60 min with peptidyl fluoromethylketones.
to different oil concentrations are shown as growth curves Both z-DEVD-fmk (caspase-3 inhibitor) and z-VAD-fmk (Fig 2a,b). At the lowest concentration (0.005%), no (broad-spectrum caspase inhibitor) (20 mM) significantly difference in cell growth could be revealed between control decreased the percentage of TUNEL-positive cells in both and TTO-treated cells, both in parental and resistant cell sensitive and resistant cell cultures. Such results indicated lines. The presence of 0.01% TTO did not affect the growth that DNA fragmentation was dependent on caspase of M14 WT cells, whereas it induced a slight, but significant, activation. Experiments of cell viability, based on the Trypan THE JOURNAL OF INVESTIGATIVE DERMATOLOGY Figure 3Apoptosis induced in human melano-ma M14 WT (white columns) and M14ADR (black columns) cells by differentconcentrations of TTO and after dif-ferent exposure times. The AI wasexpressed as the percentage of cellsbinding annexin V but negative for PI.
Mean values and SD from three differentexperiments.
Apoptosis induced in human melanoma M14 WT (black columns) Apoptosis induced in human melanoma M14 WT (black columns) and M14 ADR (gray columns) cells by the treatment with MoAb and M14 ADR (gray columns) cells by serum starvation. In white CH11 (25 mg per mL) for 24 h. In white columns AI of relative control columns AI of relative control cultures are reported. The AI was cultures are reported. The AI was expressed as the percentage of cells expressed as the percentage of cells binding annexin V but negative for binding annexin V but negative for PI. Mean values and SD from three PI. Mean values and SD from three different experiments.
blue exclusion method, were also performed (Fig 7b,d). Thepresence of caspase inhibitors did not influence the analyses were performed on control and treated M14 cells.
percentage of cells able to extrude the dye in M14 WT SEM observations revealed a concentration-dependent cultures treated with terpinen-4-ol. By contrast, both in M14 effect of the plant extract on cell surface morphology WT cells treated with TTO, and in M14 ADR cells treated (Figs 8 and 9). Control M14 WT and M14 ADR cultures with terpinen-4-ol, an increase of about 12% of the number displayed elongated bipolar or polygonal cells, with the of viable cells was detected. Finally, in the resistant cell surface covered by randomly distributed microvilli (Figs 8a population, treatment with TTO in the presence of z-DEVD- and 9a, respectively). After treatment for 48 h with the fmk or z-VAD-fmk induced an increase of viability of about lowest dose (0.005%) of TTO, both parental and resistant 23%. In this last case, the presence of a percentage of dead cells showed a surface morphology similar to untreated cells following other death pathways cannot be ruled out.
cells (Figs 8b and 9b, respectively). The treatment for 48 h Control z-FA-fmk inhibitor (a chymase inhibitor) did not with 0.01% TTO did induce significant morphologic impair TTO (data not shown) and terpinen-4-ol apoptotic changes in both M14 WT and M14 ADR cells (Figs 8c and death (Fig 7c).
9c, respectively); however, rounded and suffering cells weredetectable more frequently in the resistant cell cultures (Fig Electron microscopy analysis To get a better insight into 9c, arrow) than in the sensitive ones. Finally, 0.02% TTO 48 the effects of TTO on human melanoma cells, SEM and FF h-treated cells displayed evident changes in the cell shape 122 : 2 FEBRUARY 2004 EFFECTS OF TEA TREE OIL ON MELANOMA CELLS Table I. Negative exponential correlations between cell pool observations, numerous blebs protruding from the cell size and AI of M14 WT and M14 ADR melanoma cells after 48, surface were observed (Fig 12a). Membrane blebs dis- 72, and 96 h of treatment with TTO played both clustered intramembrane particles (Fig 12b)and smooth lipid areas (Fig 12c). In addition, in treated cells globular lipid domains of about 200 to 250 nm in diameter y ¼ 64.761 e(4.8062e–05x) y ¼ 63.007 e(7.5714e–05x) were revealed; this phenomenon was particularly evident on the protoplasmic fracture face (Fig 13) where the intramem- brane particles are more numerous. These smooth lipid y ¼ 38.095 e(1.8395e–05x) y ¼ 45.083 e(2.6569e–05x) domains tended to extrude from the plasma membrane (Fig 13b) suggesting a reorganization of membrane lipidsinduced by TTO.
y ¼ 32.179 e(5.3579e–06x) y ¼ 19.759 e(9.0404e–10x) A drug-resistant cell line (M14 ADR) was selected afternumerous passages (
100) in the presence of 40 mM DOX.
The low expression of P-gp in drug-sensitive M14 WT cellswas not detected by western blot technique. On thecontrary, in agreement with previous studies performed byour group (Molinari et al, 1998), reverse transcription–PCRof M14 WT cells demonstrated the presence of the mRNA ofMDR1 gene. In fact, in established human melanoma celllines, such as M14, H14, and JR8, which never underwentcytotoxic drug treatment, P-gp was absent on the plasmamembrane but it was clearly expressed in the Golgiapparatus, thus accounting for the intrinsic resistance ofhuman melanoma. The exposure to DOX induced theoverexpression of the total MDR transporter and itsappearance on the plasma membrane, as already observedin other drug-selected M14 cell lines (Molinari et al, 2000).
In a previous paper the cytotoxic effects of TTO were analyzed on human epithelial and fibroblast cells at Apoptosis induced in sensitive (M14 WT) and resistant (M14 ADR) concentrations ranging from 10 to 1000 mg per mL melanoma cells by treatment with terpinen-4-ol in the presence or (So¨derberg et al, 1996). The cell lines employed in that absence of CsA. Mean values and SD from three different experi-ments.
study were chosen as they have similar susceptibilities asbasal keratinocytes, to topical agents (Teepe et al, 1993).
and alterations of the surface morphology with loss of The authors reported that concentrations of TTO lower than microvilli and the formation of numerous blebs. These 300 mg per mL (
0.03%) were not cytotoxic for the tested modifications were detectable on most M14 WT cells lines. In this study human melanoma M14 WT and M14 ADR (Fig 8d) and appeared to be even more evident on resistant cells were grown in the presence of TTO at the concentra- M14 ADR cells (Fig 9d).
tions ranging from 0.005 to 0.03%. The two higher Similar morphologic changes were detected in M14 WT concentrations (0.02% and 0.03%) appeared to be strongly and M14 ADR cell cultures treated with 0.01% terpinen-4-ol inhibitory for both the growth of both parental M14 WT and for 48 h (Fig 10). A higher number of detaching and blebbing resistant M14 ADR cells; however, the effect proved to be cells were observed in treated resistant cell cultures (Fig more pronounced in the M14 ADR cell line than in the M14 10c,d) when compared with sensitive ones (Fig 10a,b).
Noteworthy, typical alterations of plasma membrane were The analysis performed by the annexin V binding method detectable in terpinen-4-ol-treated cells (Fig 10d), visible revealed that the treatment with TTO induced the increase more frequently in M14 ADR cells.
of apoptotic cell number in both M14 WT and M14 ADR cell Moreover, in order to analyze the possible effects of TTO populations. It has been shown that loss of phospholipid on the molecular organization of the plasma membrane of asymmetry of the plasma membrane is an early event of human melanoma cells, sensitive and resistant M14 cells apoptosis. The annexin V binds to negatively charged were also examined by FF, before and after treatment with phospholipids, such as phosphatidylserine. During apopto- 0.02% TTO for 48 h. In control M14 WT and M14 ADR cells, sis the cells react to annexin V as soon as chromatin protein intramembrane particles appeared randomly dis- condenses but before the plasma membrane loses its ability tributed on both exoplasmic (Fig 11a) and protoplasmic to exclude dyes such as PI (Vermes et al, 1995).
(Fig 11b) fracture faces of the plasma membrane. After Noteworthy, the AI values detected in treated samples were treatment with TTO, morphologic alterations typical of generally greater in the resistant variant cell population than apoptosis were detected, particularly on resistant M14 in the parental one. Moreover, there was a negative ADR cells (Fig 12). In fact, in agreement with SEM correlation between the AI and the cell pool size. These THE JOURNAL OF INVESTIGATIVE DERMATOLOGY Figure 7Percent apoptosis (a,c) and cell survival(b,d) in sensitive (M14 WT) and resistant(M14 ADR) melanoma cells by treat-ment with TTO (a,b) or terpinen-4-ol(c,d) in the presence or absence ofcaspase inhibitors. Mean values and SDfrom three different experiments.
Figure 8Scanning electron microscopy ofhuman melanoma M14 WT cell cul-tures. (a) Control cells. Cells treatedwith (b) 0.005% TTO, (c) 0.01% TTO,and (d) 0.02% TTO.
correlations might by themselves indicate that the cell pool of resistant cells to this component when compared with size of treated M14 cultures, when compared with untreated the sensitive ones.
ones, is primarily determined by apoptosis, i.e., that the Previous data demonstrated that functional P-gp can interaction with TTO stimulates programmed cell death in confer resistance to a wide range of caspase-dependent melanoma cells. As the active component of the oil is apoptotic stimuli, such as ligation of cell surface death thought to be terpinen-4-ol (Altman, 1988), additional receptors, serum starvation, and ultraviolet irradiation experiments were performed by employing this component (Robinson et al, 1997; Smyth et al, 1998). In particular, at the concentration close to that detected in the employed functional P-gp inhibited activation of caspase-3 following crude oil mixture (about 50%). Data obtained from terpinen- Fas ligation and this inhibitory effect could be reversed 4-ol experiments clearly confirmed the higher susceptibility using P-gp antagonists such as specific anti-P-gp MoAb or 122 : 2 FEBRUARY 2004 EFFECTS OF TEA TREE OIL ON MELANOMA CELLS Figure 9Scanning electron microscopy ofhuman melanoma M14 ADR cellcultures. (a) Control cells. Cells treatedwith (b) 0.005% TTO, (c) 0.01% TTO,and (d) 0.02% TTO.
Figure 10Scanning electron microscopy ofhuman melanoma M14 WT (a,b)and M14 ADR cells (c,d) treated with0.01% terpinen-4-ol for 48 h.
pharmacologic inhibitors (Smyth et al, 1998). Many che- (Johnstone et al, 1999; Smyth et al, 1998; Trapani et al, motherapeutic drugs, such as doxorubicin and vincristine, 1998). At least two molecular pathways leading to caspase- function in a caspase-dependent manner (Smyth et al, dependent apoptosis have been defined. The best-defined 1998; Johnstone et al, 1999); therefore, P-gp may play a pathway involves ligation of death receptors, typically dual role in regulating cell death induced by these stimuli (1) members of the tumor necrosis factor superfamily such as by removing the toxins from the cells, and (2) by inhibiting Fas and tumor necrosis factor receptor, at the cell surface the activation of caspases. Importantly, P-gp does not offer resulting in sequential activation of proximal caspase-8 and cell protection from death induced by lytic concentrations of downstream effector caspases such as caspase-3 (Boldin the pore-forming protein perforin (Johnstone et al, 1999) or et al, 1996; Muzio et al, 1996; Srinivasula et al, 1996; by combination of granzyme B and sublytic concentrations Walczak and Krammer, 2000). The second caspase- of perforin (Smyth et al, 1998; Johnstone et al, 1999), which dependent pathway involves disruption of the mitochondrial together can function in a caspase-independent manner transmembrane potential and the release of mitochondrial THE JOURNAL OF INVESTIGATIVE DERMATOLOGY Figure 12FF human melanoma M14 ADR cells. (a) Cross-fracture of a celltreated with 0.02% TTO, displaying numerous polarized blebs.
Membrane blebs displayed both clustered intramembrane particles(b) and smooth lipid areas (c).
Figure 11Plasma membrane of FF human melanoma M14 cells. (a)Exoplasmic fracture face of a M14 WT cell. (b) Protoplasmic fractureface of a M14 ADR cell.
inhibitors (z-VAD-fmk, Z-DEVD-fmk) indicated that TTO andterpinen-4-ol induced a caspase-dependent form of apop- proteins such as cytochrome c (Liu et al, 1996; Kluck et al, tosis, overcoming P-gp protection. Preliminary results 1997; Nagata, 2000) and apoptosis-inducing factors (Susin obtained by JC1 staining (data not shown) indicated a et al, 1999).
depolarization of mitochondria after treatment with both the Results obtained in this study clearly demonstrated that oil and the active component suggesting that the activation P-gp does not protect against TTO- or terpinen-4-ol- of caspase-3 could result from disruption of mitochondrial stimulated apoptosis. Indeed, P-gp-positive (M14 ADR) membrane potential, release of cytochrome c, and sub- cells showed to be more susceptible to TTO- or terpinen-4- sequent activation of caspase 9.
ol- action. Moreover, a role of P-gp in the induction of The effect of TTO on the plasma membrane has been apoptosis seems to be ruled out by the results of the previously hypothesized as terpenes are lipophilic and experiments performed by using the combined treatment of partition into the phospholipid layer of cell membranes, the oil with CsA. In fact, CsA, the well known P-gp disrupting normal structure and function (Sikkema et al, modulator agent (Saeki et al, 1993) did increase remarkably 1995). Although the in vitro anti-microbial activity and in vivo the number of apoptotic cells mainly in wild-type melanoma efficacy of TTO have been reported, less is known about cells, which express low levels of the drug transporter. In its mechanism of action. TTO is well characterized and resistant cells the effects of terpinen-4-ol and CsA contains approximately 100 terpenes and their related appeared to be simply additive in the combined treatment.
alcohols (Brophy et al, 1989). It is well known that cyclic As P-gp-positive cells remain sensitive to caspase-inde- hydrocarbons, such as aromatics, alicycles, and terpenes, pendent death, it can be argued that TTO and its active interact with biologic membranes (Uribe et al, 1985). These component induce apoptosis through this pathway. Note- interactions lead to changes in structure and function of the worthy, experiments performed in the presence of caspase membranes, which in turn, may impair growth and activity 122 : 2 FEBRUARY 2004 EFFECTS OF TEA TREE OIL ON MELANOMA CELLS of sphingomyelin during apoptosis cause concomitantcholesterol efflux and, thus, significant alterations in thebiophysical properties of the plasma membrane, which is aprerequisite for membrane blebbing and vesiculation at thesurface of the apoptotic cell (Tepper et al, 2000). TTO andterpinen-4-ol, at concentrations lower than 0.03%, perturbmolecular architecture of the plasma membrane withoutcompletely disrupting it, thus stimulating programmed celldeath.
The majority of current anti-cancer therapies induce tumor cell death through the induction of apoptosis.
Alterations in the apoptotic pathways may determine tumorresistance to these therapies (Coultas and Strasser, 2000).
Activation of the proteolytic cascade involving caspasefamily members is a critical component of the execution ofcell death in apoptotic cells. Recent studies, however, suggest that cell death can proceed in the absence of Plasma membrane of FF human melanoma M14 ADR cells. Lipid caspases (Kolenko et al, 2000).
domains of about 200 to 250 nm were detectable on the protoplasmicfracture face (a,b). These smooth lipid domains tended to extrude from Further studies are now in progress to explore the the plasma membrane (b).
pathway of TTO or terpinen-4-ol-induced programmed celldeath. It is noteworthy that these compounds are appar- of the cells (Sikkema et al, 1992). Toxic effects on ently able to overcome P-gp-mediated resistance to the membrane structure and function have generally been used caspase-dependent form of apoptosis. A better under- to explain the anti-microbial action of essential oils and their standing of the mechanism of action of TTO and of the monoterpenoid components (Uribe et al, 1985; Knobloch diverse modes of tumor cell death will help to avoid et al, 1988). Sikkema et al (1994) showed that, as a result of ineffective anti-tumor treatments. Moreover, TTO might their lipophilic character, cyclic hydrocarbons will preferen- offer promising applications in combined therapy with tially partition from an aqueous phase into membrane classical cytotoxic agents, in particular against drug- structures. This results in membrane expansion, increased membrane fluidity and inhibition of membrane-embeddedenzymes. Consequently, the interaction with the hydropho-bic structures of bacteria play a key role in the anti-microbial Material and Methods action of hydrocarbons (Sikkema et al, 1995). Cox et al Cell cultures The established human melanoma cell line (M14 (2000) confirmed that the anti-microbial activity of TTO WT) and its derivative MDR variant (M14 ADR) were grown in RPMI results from its ability to disrupt the permeability barrier of 1640 medium (Flow Laboratories, Irvine, UK) supplemented with microbial membrane structures. In fact, they observed an 1% nonessential amino acids, 1% L-glutamine, 100 IU per mL increased cell permeability to the fluorescent nucleic acid penicillin, 100 IU per mL streptomycin, and 10% fetal calf serum stain PI. Similarly, Carson et al, (2002) reported that TTO (Flow Laboratories) at 371C in a 5% CO2 humidified atmosphere inair. M14 ADR cell line was selected culturing M14 cells in the and its components compromise the cytoplasmic mem- presence of 40 mM DOX (Adriblastina, Pharmacia & Upjohn S.P.A., branes of Staphylococcus aureus.
Milan, Italy). All procedures were performed with written institu- So¨derberg et al (1996) hypothesized that the cytotoxic tional review board approval.
activity of TTO on human epithelial and fibroblastic cells isprobably exerted by membrane-associated reactions. In our Chemicals M. alternifolia essential oil (Pharmaceutical Grade) was study, results obtained by SEM and FF experiments strongly kindly supplied by Variati (Milan, Italy). ( þ )-Terpinen-4-ol and 1,8- suggested a preferential interaction of both TTO and cineole were purchased from Fluka (Buchs, Switzerland) andSigma-Aldrich (St Louis, Missouri), respectively. The oligopeptide terpinen-4-ol with the membranes of resistant M14 cells.
caspase inhibitors z-Val-Ala-Asp-fluoromethylketone (z-VAD-fmk), MDR is usually mediated by overexpression of P-gp; a large z-Phe-Ala-fluoromethylketone (z-FA-fmk), and z-Asp(Ome)-val- body of work indicates that MDR is also associated with Asp-(Ome)-fluoromethylketone were purchased from Enzyme marked changes in membrane lipid composition (Lavie et al, Systems Products (San Diego, California). CsA was obtained from 1999; Santini et al, 2001). In particular, elevated levels of Sigma (Sigma, St Louis, Missouri).
cholesterol, glycosphingolipids, and sphingomyelin have Gas chromatography (GC-FID) and gas chromatography-mass been reported. The greater sensitivity to the TTO treatment spectrometry (GC-MS) Gas chromatography equipment used displayed by M14 ADR cells when compared with parental included a Perkin Elmer AutoSystem (Perkin Elmer Corporation, ones could be due to different lipid composition of the Norwalk, CT) equipped with two fused-silica SPB 5 columns (60 plasma membrane.
m  0.25 mm i.d., film thickness 0.25 mm), mounted in parallel in Our results clearly demonstrated that TTO and terpinen- the same oven, with two detectors: FID and TurboMass Spectro- 4-ol are able to interfere with the growth of human meter (electron ionization 70 eV electron energy, transfer line2201C). Carrier gas was oxygen and moisture-free helium obtained melanoma cells stimulating programmed cell death as from SUPELCOTM High Capacity Heated Carrier Gas Purifier, evaluated by annexin V binding experiments, which exclude provided with OMI-2 indicating tube, at the average flow rate of 1 PI stained cells, and in situ DNA fragmentation labeling. On mL per min. Oven temperature program was 601C for 4 min, then the other hand, the transbilayer movement and breakdown 21C per min to 1801C, then 31C per min to 2501C. Detector THE JOURNAL OF INVESTIGATIVE DERMATOLOGY temperature was 2801C; injector temperature was 2801C. The excluded from the analysis by adding propidium iodide (PI) to the volume of injected essential oil or reference substances (( þ )- cell suspensions before the acquisitions. For negative controls, Terpinen-4-ol and 1,8-cineole) was 0.1 mL and the split ratio was cells were incubated with mouse IgG2a isotypic globulins.
1:50. Two distinct data systems were connected to the GC-FID or For the measurement of annexin V binding, cells from GC-MS: Turbochrom and TurboMass Analytical Workstation Soft- exponentially growing control and TTO-treated cultures were ware with NIST/EPA/MSDC Mass Spectral database, respectively.
collected at the time indicated, by adding the floating cells to theEDTA-detached ones and analyzing them together. Aliquots of Growth curves M14 WT and M14 ADR cells (5  103) were 0.5  106 cells were centrifuged (100 g) for 5 min and washed with seeded in 24 multiwell tissue culture plates. After 24 h, cultures incubation buffer (10 mM HEPES/NaOH, 140 mM NaCl, 5 mM were treated with TTO at concentrations ranging from 0.005 to CaCl2). The cell pellet was resuspended in 200 mL of labeling 0.03% (v/v). Cells were then counted every day in a Neuebauer solution containing 1 mL annexin V-fluorescein isothiocyanate chamber. Dead cells were subtracted by employing the Trypan labeling reagent (MBL, Medical & Biological Laboratory Co., Ltd, blue exclusion method. The cell pool size represented the mean Naka-ku Nagoya, Japan) and incubated for 10 to 15 min. After value of the number of cells collected from three wells.
adding 200 mL of incubation buffer, cells were washed andresuspended in 200 mL containing 1 mL PI solution. The apoptotic Cytotoxicity studies The clonogenic survival test was used to index (AI) was expressed as the percentage of cells binding determine the cell sensitivity to DOX. After treatment with DOX at annexin V but negative for PI. The in situ DNA fragmentation the concentrations ranging from 0.42 to 60 mM for 1 h, cells were labeling was performed by the TUNEL (terminal deoxynucleotidyl detached, plated (1000 per 60 mm tissue culture dish), and allowed transferase-mediated deoxyuridine triphosphate nick end-label- to grow for 8 d. After growth, cell colonies were fixed with 95% ing). Aliquots of about 105 cells were fixed in formaldehyde (1% in ethanol, for 15 min, and stained with a solution of methylene blue in PBS) for 15 min at room temperature. After, cells were rinsed in ice- 80% ethanol, for 1 h. Only colonies composed of more than 50 cold PBS, incubated with ethanol for 2 min on ice, rinsed in ice- cells were evaluated. The surviving fraction (SF) was calculated by cold PBS and resuspended in TUNEL reaction mixture (Roche dividing the absolute survival of cells treated with the drug (S Molecular Biochemicals, Mannheim, Germany) for 60 min at 371C by the absolute survival of cells grown in drug-free medium (S in humidified atmosphere in the dark. After washing in ice-cold PBS, cells were analyzed by flow cytometry. In order to evaluate DOX/SDFM  100). The values calculated depict the mean of three separate experiments. The resistance index was calculated the viability of M14 WT and M14 ADR cells after treatment with TTO as the ratio of the IC50 (inhibitory concentration of the growth of or terpinen-4-ol, in the presence or absence of caspase inhibitors, 50% cell population) of M14 ADR cells to the IC50 of M14 WT cells.
the trypan blue (Gibco BRL Life Technologies, Gaithersburg,Maryland) exclusion method was carried out. After treatment, cells Western blotting Cultured cells were washed three times in cold were resuspended in ice-cold PBS, stained with trypan blue at a phosphate buffer solution, and incubated for 30 min on ice in lysis final concentration of 80 mM and immediately analyzed by flow buffer (150 mM NaCl, 50 mM HEPES, 10 mM EDTA, 1% Triton X-100) cytometry. All fluorescences were analyzed with a FACScan flow supplemented with protease inhibitor cocktail (one tablet per cytometer (Becton Dickinson, Mountain View, California) equipped 10 mL of incubation solution) (Complete; Boehringer Mannheim with a 15 mW, 488 nm, air-cooled argon ion laser. The fluorescence GmbH, Mannheim, Germany). Debris and nuclei were pelleted by emissions were collected through a 530 nm band-pass filter for centrifugation at 10,000 g for 5 min. The protein concentration in fluorescein and annexin V, a 575 nm band-pass filter for PI, a 670 the resulting supernatants was measured by using a Dc Protein nm band-pass filter for trypan blue, and acquired in log mode. At Assay (Bio-Rad Laboratories, Hercules, California). Samples of 30 least 10,000 events were analyzed. The analyses were performed mg of total protein were boiled in sample buffer and analyzed on by CellQuest software (Becton Dickinson).
4% sodium dodecyl sulfate–polyacrylamide gel electrophoresisand electrophoretically transferred on to nitrocellulose membrane Electron microscopy For scanning electron microscopy (SEM) (Millipore Corporation, Bedford, Massachusetts). The membrane analysis, cells were grown on 12 mm glass coverslips and treated was probed with the primary monoclonal antibodies (MoAb) to P- as above reported. At the indicated times, cells were fixed with 2% gp, MoAb C219 (Signet Laboratories Inc., Dedham, Massachu- glutaraldehyde in 0.1 M cacodylate buffer, pH 7.4 at room setts) (work dilution 1:20) and to actin, MoAb 1501 (work dilution temperature for 30 min, postfixed with 1% OsO4 in the same 1:5000) (Chemicon International Inc. Temecula, CA). All the buffer, dehydrated through a graded ethanol series, critical point incubations and washes were performed in PBS, containing dried with CO2, and gold coated by sputtering. Samples were 0.1% Tween 20. As secondary antibody, sheep anti-mouse examined with a Cambridge Stereoscan 360 scanning electron immunoglobulin horseradish peroxidase-linked (whole antibody) microscope (Cambridge Instruments Ltd, Cambridge, UK).
(Amersham Pharmacia Biotech UK Limited, Little Chalfont, UK) For analyses on freeze-fracture (FF) replicas, cells were fixed was used, according to the manufacturer's instructions. Detection with 2.5% glutaraldehyde in the culture medium. After 20 min of was accomplished using the Enhanced Chemiluminescence fixation, cells were centrifuged for 10 min at 100 g, washed twice in detection kit (Amersham Pharmacia Biotech UK Limited). Experi- Hank's balanced salt solution, resuspended in the same medium ments were repeated three times.
containing 25% glycerol and incubated for 20 min at roomtemperature. The suspension was then centrifuged at 450 g for Flow cytometry For flow cytometric analysis, cell surface P-gp 15 min and the pellet was put on carriers and quickly frozen in was labeled with MoAb MM4.17 (Cianfriglia et al, 1994). MoAb Freon 22, partially solidified at the liquid nitrogen temperature. The MM4.17 is an IgG2ak monoclonal immunoglobulin reacting with a mounted carriers were then transferred into a Bal-Tec BAF 060 continuous linear epitope on the apex of the fourth loop of P-gp.
freeze-etch unit (BAL-TEC Inc., Balzers, Liechtenstein), cleaved at This MoAb specifically recognizes a distinct human-specific 1001C at a pressure of 2 to 4  10–7 mbar, shadowed with 2.5 nm epitope of the extracellular domain of the MDR1-P-gp isoform.
of platinum-carbon and replicated with 20 nm carbon film.
The optimal concentration for these studies was 10 mg per mL.
Platinum-carbon evaporation (at an angle of 451) an carbon For the determination of cell surface P-gp, the cells were evaporation (at an angle of 901) were performed using electron incubated for 30 min at 41C with MoAb MM4.17 in PBS, pH 7.2 beam guns; the thickness of the deposit was evaluated by means containing 1% bovine serum albumin (Sigma), 10% fetal calf of a quartz crystal thin film monitor. Cells were digested for 2 h from serum, and 10% human AB serum. After washing with ice-cold the replica by chlorox. The replicas were mounted on naked PBS cells were incubated for 30 min at 41C with a F(ab0)2 fragment 300 mesh grids and examined with a Philips EM 208S elec- of goat anti-mouse IgG-fluorescein conjugate (Sigma). After tron microscope (FEI Company, Eindhoven, the Netherlands) washing, cells were immediately analyzed. Dead cells were 122 : 2 FEBRUARY 2004 EFFECTS OF TEA TREE OIL ON MELANOMA CELLS Reverse transcription–polymerase chain reaction (reverse Carson CF, Riley TV, Cookson BD: Efficacy and safety of tea tree oil as a topical transcription–PCR) MDR1 mRNA was analyzed by the reverse antimicrobial agent. J Hospital Infect 40:175–178, 1998 transcription–PCR technique. Total cellular RNA was isolated by Carson CF, Mee BJ, Riley TV: Mechanism of action of Melaleuca alternifolia (tea the acid guanidinium thiocyanate–phenol–cloroform extraction tree) oil on Staphylococcus aureus determined by time-kill, lysis, leakage, method using TRIZOL reagent (Gibco-BRL); the concentration of and salt tolerance assays and electron microscopy. Antimicrob Agents RNA was determined spectrophotometrically at 260 nm. RNA Chemother 46:1914–1920, 2002 preparations were treated with Dnase I-Rnase-free (1 U per 5 mL, Cianfriglia M, Willingham MC, Tombesi M, Scagliotti V, Frasca G, Chersi A: Boehringer-Mannheim, Milan, Italy) before cDNA synthesis. First- P-glycoprotein epitope mapping Identification of a linear human specificepitope in the fourth loop of the P-glycoprotein extracellular domain by strand cDNA and amplification of specific DNA sequence were MM4.17 murine monoclonal antibody to human multi-drug resistance performed according to the manufacturer's instructions (Gen- cells. Int J Cancer 56:153–160, 1994 eAmp, RNA PCR Kit, Perkin Elmer Cetus, Emeryville, California).
Cole SP, Bhardwaj G, Gerlach JH, et al: Overexpression of a transporter gene in a Briefly 1 mg of total RNA was used for cDNA synthesis using multidrug-resistant human lung cancer cell line. Science 258:1650–1654, oligo(dt) priming in the presence of Moloney murine leukemia virus reverse transcriptase. The total cDNA reaction mixture (20 mL) was Coultas L, Strasser A: The molecular control of DNA damage-induced cell death.
used for amplification of the MDR1. After an initial denaturation Apoptosis 5:491–507, 2000 step at 941C for 3 min, the cycling profile was: 941C, 45 s Cox SD, Mann CM, Markham JL, Bell NC, Gustafson JE, Warmington JR Wyllie SG: The mode of antimicrobial action of the essential oil of Melaleuca 1C, 45 s annealing; 721C, 1 min extension and alternifolia (tea tree oil). J Appl Microbial 88:170–175, 2000 1C in a 9600 thermocycler (Perkin Elmer). A total of D'Auria FD, Laino L, Strippoli V, Tecca M, Salvatore G, Battinelli L, Mazzanti G: In 40 cycles were performed. MDR1 specific sequences were vitro activity of tea tree oil against Candida albicans mycelial conversion amplified using the sense-strand primer CCCATCATTGCAATAG- and other pathogenic fungi. J Chemother 13:377–383, 2001 CAGG (residues 2596–2615) and the anti-sense strand primer Ernst E, Huntley A: Tea tree oil: A systematic review of randomized clinical trials.
GTTCAAACTTCTGCTCCTGA (residues 2733–2752), which yield a Forsch Komplementarmed Klass Naturheilkd 7:17–20, 2000 167 bp product. The PCR products were fractioned in a 2% Hart PH, Brand C, Carson CF, Riley TV, Prager RH, Finlay-Jones JJ: Terpinen-4- agarose gel and visualized by ethidium bromide staining. As a ol, the main component of the essential oil of Melaleuca alternifolia (tea positive control, MCF7-DX cells expressing a high level of P-gp tree oil), suppresses inflammatory mediator production by activated were employed. Several negative control reactions were included human monocytes. Inflamm Res 49:619–626, 2000 in each experiment. Experiments were repeated three times.
Johnstone RW, Cretney E, Smyth MJ: P-glycoprotein protects leukemia cells against caspase-dependent, but not caspase-independent, cell death.
Blood 93:1075–1085, 1999 Kluck RM, Bossy-Wetzel E, Green DR, Newmeyer DD: The release of cytochrome c from mitochondria: A primary site for Bcl-2 regulation of apoptosis.
This work was partially supported by Ministero della Salute (1% FondoSanitario Nazionale). The authors are grateful to Mr Lamberto Camilli Science 275:1132–1136, 1997 for technical assistance.
Knobloch K, Pauli A, Iberl B, Weis N, Wigand H: Antibacterial activity and antifungal properties of essential oil components. J Ess Oil Res 1:119– Kolenko VM, Uzzo RG, Bukowski R, Finke JH: Caspase-dependent and - Manuscript received August 20, 2002; revised September 30, 2003; independent death pathways in cancer therapy. Apoptosis 5:17–20, 2000 accepted for publication October 1, 2003 Lavie Y, Fiucci G, Czarny M, Liscovitch M: Changes in membrane microdomains and caveolae constituents in multidrug-resistant cancer cells. Lipids Address correspondence to: Agnese Molinari, Laboratorio di Ultra- strutture, Istituto Superiore di Sanita Viale Regina Elena 299, 00161 Liu X, Kim CN, Yang J, Jemmerson R, Wang X: Induction of apoptotic program Rome, Italy. Email: [email protected] in cell-free extracts: Requirement for dATP and cytochrome c. Cell86:147–157, 1996 Markham JL: Biological activity of tea tree oil. In: Southwell I, Lowe R (eds). Tea Tree, the Genus Melaleuca. Amsterdam: Harwood Academic Publishers, 1999; p 169–190 May J, Chan CH, King A, Williams L, French GL: Time-kill studies of tea tree oils Adams RP: Compounds listed in order to their retention time. In: Adams RP (ed.).
on clinical isolates. J Antimicrob Chemother 45:639–643, 2000 Identifications of Essential Oil Components by Gas Chromatography/ Molinari A, Calcabrini A, Meschini S, Stringaro A, Del Bufalo D, Ciafriglia M, Mass Spectroscopy. Carol Stream, Illinois: Allured Publishing Corpora- Arancia G: Detection of P-glycoprotein in the Golgi apparatus of drug tion, 1995; p 31–43 untreated melanoma cells. Int J Cancer 75:885–893, 1998 Altman PM: Australian tea tree oil. Aust J Pharm 69:276–278, 1988 Molinari A, Toccacieli L, Calcabrini A, Diociaiuti M, Cianfriglia M, Arancia G: Alvarez M, Paull K, Monks A, et al: Generation of a drug resistance profile by Induction of P-glycoprotein expression on the plasma membrane of quantitation of mdr1/P-glycoprotein in the cell lines of the National human melanoma cells. Anticancer Res 20:2691–2696, 2000 Cancer Institute Anticancer Drug Screen. J Clin Invest 95:2205–2214, Muzio M, Chinnaiyan AM, Kischkel FC, et al: FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) death- Anderson JN, Fennessy PA: Can tea tree (Melaleuca alternifolia) oil prevent inducing signaling complex. Cell 85:817–827, 1996 MRSA? Med J Aust 173:489, 2000 Nagata S: Apoptotic DNA fragmentation. Exp Cell Res 256:12–18, 2000 Bassett IB, Pannowitz DL, Barnetson RS: A comparative study of tea-tree oil Nenoff P, Haustein U, Brandt W: Antifungal activity of the essential oil of versus benzoylperoxide in the treatment of acne. Med J Aust 153:455– Melaleuca alternifolia (tea tree oil) against pathogenic fungi in vitro. Skin Pharmacol 9:388–394, 1996 Berger W, Elbling L, Minai-Pour M, Vetterlein M, Pirker R, Kokoschka EM, Robinson LJ, Roberts WK, Ling TT, Lamming D, Sternberg SS, Roepe PD: Micksche M: Intrinsic MDR-1 gene and P-glycoprotein expression in Human MDR1 protein overexpression delays the apoptotic cascade human melanoma cell lines. Int J Cancer 59:717–723, 1994 in Chinese hamster ovary fibroblasts. Biochemistry 36:11169–11178, Boldin MP, Goncharov TM, Goltsev YV, Wallach D: Involvement of MACH, a novel MORT1/FADD-interacting protease, in fas/APO-1 and TNF receptor- Saeki T, Veda K, Tanigawara Y, Hori R, Komano T: Human P-glycoprotein induced cell death. Cell 85:803–815, 1996 transports cyclosporin A and FK506. J Biol Chem 268:6077–6080, 1993 Brophy JJ, Davies NW, Southwell IA, Stiff IA, Williams LR: Gas chromatographic Santini MT, Romano R, Rainaldi G, et al: The relationship between 1H-NMR quality control for oil of Melaleuca terpinen-4-ol type (Australian tea tree).
mobile lipid intensity and cholesterol in two human tumor multidrug J Agr Food Chem 37:1330–1335, 1989 resistant cell lines (MCF-7 and LoVo). Biochim Biophys Acta 1531: Caelli M, Porteous J, Carson CF, Heller R, Riley TV: Tea tree oil as an alternative topical decolonization agent for methicillin-resistant Staphylococcus Schadendorf D, Worm M, Algermissen B, Kohlmus CM, Czarnetzki BM: aureus. J Hospital Infect 46:236–237, 2000 Chemosensitivity testing of human malignant melanoma. A retrospective Carson CF, Riley TV: Antimicrobial activity of the major components of the analysis of clinical response and in vitro drug sensitivity. Cancer 73:103– essential oil of Melaleuca alternifolia. J Appl Bacteriol 78:264–269, 1995 THE JOURNAL OF INVESTIGATIVE DERMATOLOGY Sikic BI: Modulation of multidrug resistance: At the threshold. J Clin Oncol Syed TA, Qureshi ZA, Ali SM, Ahmad S, Ahmad SA: Treatment of toenail 11:1629–1635, 1993 onychomycosis with 2% butenafine and 5% Melaleuca alternifolia (tea Sikkema J, Poolman B, Konings WN, de Bont JA: Effects of the membrane action tree) oil in cream. Trop Med Int Health 4:284–287, 1999 of tetralin on the functional and structural properties of artificial and Teepe RG, Koebrugge EJ, Lo¨wik CW, et al: Cytotoxic effects of topical bacterial membranes. J Bacteriol 174:2986–2992, 1992 antimicrobial and antiseptics agents on human keratinocytes in vitro.
Sikkema J, de Bont JA, Poolman B: Interactions of cyclic hydrocarbons with J Trauma 35:8–19, 1993 biological membranes. J Biol Chem 269:8022–8028, 1994 Tepper AD, Ruurs P, Wiedmer T, Sims PJ, Borst J, van Blitterswijk WJ: Sikkema J, de Bont JA, Poolman B: Mechanisms of membrane toxicity of Sphingomyelin hydrolysis to ceramide during the execution phase of hydrocarbons. Microbiol Rev 59:201–222, 1995 apoptosis results from phospholipid scrambling and alters cell-surface Smyth MJ, Krasovskis E, Sutton VR, Johnstone RW: The drug efflux protein, morphology. J Cell Biol 150:155–164, 2000 P-glycoprotein, additionally protects drug-resistant tumor cells from Tong MM, Altman PM, Barnetson RS: Tea tree oil in the treatment of Tinea pedis.
multiple forms of caspase-dependent apoptosis. Proc Natl Acad Sci USA Australas J Dermatol 33:145–149, 1992 95:7024–7029, 1998 Trapani JA, Jans DA, Jans PJ, Smyth MJ, Browne KA, Sutton VR: Efficient nuclear So¨derberg TA, Johansson A, Gref R: Toxic effects of some conifer resin acids targeting of granzyme B and the nuclear consequences of apoptosis and tea tree oil on human epithelial and fibroblast cells. Toxicology induced by granzyme B and perforin are caspase-dependent, but cell death 107:99–109, 1996 is caspase-independent. J Biol Chem 273:27934–27938, 1998 Southwell IA, Hayes AJ, Markham JL, Leach DN: The search for optimally Uribe S, Ramirez J, Pena A: Effects of b-pinene on yeast membrane functions.
bioactive Australian tea tree oil. Acta Hortic 334:265–275, 1993 J Bacteriol 161:1195–1200, 1985 Srinivasula SM, Ahmad M, Fernandes-Alnemri T, Litwack G, Alnemri ES: Vermes I, Haanen C, Steffens-Nakken H, Reutelingsperger C: A novel assay for Molecular ordering of the Fas-apoptotic pathway: the Fas/APO-1 apoptosis. Flow cytometric detection of phosphatidylserine expression protease Mch5 is a CrmA-inhibitable protease that activates multiple on early apoptotic cells using fluorescein labelled Annexin V. J Immunol Ced-3/ICE-like cysteine proteases. Proc Natl Acad Sci USA 93:14486– Methods 184:39–51, 1995 Walczak H, Krammer PH: The CD95 (APO-1/Fas) and the TRAIL (APO-2L) apoptosis systems. Exp Cell Res 256:58–66, 2000 tion of mitochondrial apoptosis-inducing factor. Nature 397:441–446, Zhang SY, Robertson D: A study of tea tree oil ototoxicity. Audiol Neurootol 5:

Source: http://www.erbeofficinali.org/dati/nacci/studi/terpenoide%20di%20olio%20di%20Melaleuca%20alternifolia%20induce%20APOPTOSI%20su%20MELANOMA.pdf